Association of pre-miRNA-146a rs2910164 and pre‑miRNA-499 rs3746444 polymorphisms and susceptibility to rheumatoid arthritis

  • Authors:
    • Mohammad Hashemi
    • Ebrahim Eskandari-Nasab
    • Zahra Zakeri
    • Mahdi Atabaki
    • Gholamreza Bahari
    • Mahdi Jahantigh
    • Mohsen Taheri
    • Saeid Ghavami
  • View Affiliations

  • Published online on: November 8, 2012     https://doi.org/10.3892/mmr.2012.1176
  • Pages: 287-291
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Single nucleotide polymorphisms in pre‑microRNA (miRNA) may alter miRNA expression levels or processing and contribute to susceptibility in a wide range of diseases. The present study aimed to evaluate the possible association between rs2910164 and rs3746444 of the pre-miRNA (hsa-mir-146a and hsa-mir-499) polymorphisms and susceptibility to rheumatoid arthritis (RA) in an Iranian population. This case-control study was performed on 104 patients with RA and 110 healthy individuals. Tetra amplification refractory mutation system-polymerase chain reaction was used to genotype the hsa-mir-499 rs3746444 and hsa-mir-146a rs2910164 polymorphisms. The hsa-mir-499 rs3746444 polymorphism was a risk factor for predisposition to RA in codominant [TT vs. TC: odds ratio (OR), 2.11; 95% confidence interval (CI), 1.08-4.11; p=0.029; TT vs. CC: OR, 3.88; 95% CI, 1.68-8.98; p=0.002], dominant (TT vs. TC-CC: OR, 2.64; 95% CI, 1.48-4.72; p=0.001) and recessive (TC-CC vs. CC: OR, 3.05; 95% CI, 1.36-6.83; p=0.007) tested inheritance models. In addition, the rs3746444 C allele was a risk factor for RA (OR, 2.49; 95% CI, 1.63-3.81; p<0.0001). No significant difference was found between the groups concerning the rs2910164 polymorphism (χ2=0.348, p=0.841). Our findings demonstrated that the hsa-mir-499 rs3746444, but not mir-146a rs2910164, polymorphism is associated with an increased RA risk in a sample of the Iranian population. Larger studies with different ethnicities are required to validate our findings.

Introduction

Rheumatoid arthritis (RA) is a systemic autoimmune disease which affects 0.5–1% of the general population worldwide (1). A chronic and deforming arthritis, RA is characterized by accelerated inflammatory joint destruction of articular cartilage and bone and synovial hyperplasia, which ultimately leads to severe disabilities and a poor quality of life (2,3). The etiology of RA is unknown, but genetic factors are thought to be important in the pathogenesis and progress of RA (1,4). One class of genetic variants that have recently been the center of attention are DNA polymorphisms that affect microRNA (miRNA) binding (5). miRNAs are approximately 22-nucleotide (nt) non-coding RNAs that are involved in the post-transcriptional regulation of gene expression by affecting the stability and translation of mRNAs (6). Compelling evidence indicates that miRNAs act as key regulators of various processes, including early development, cell proliferation, differentiation, stress resistance, cell fate determination, apoptosis, signal transduction and organ development (710). miRNAs are present in dried biological fluids, including semen, saliva, vaginal secretions and menstrual blood and are expected to be diagnostic and prognostic biomarkers of various diseases, including cancer and autoimmune diseases such as RA (11,12).

Abnormal expression of several miRNAs has been detected in RA in various cell types and these miRNAs regulate specific pathways, thus leading to the inflammatory milieu occurring in RA (2). Hsa-mir-499 is involved in autoimmune and inflammatory disease. The targets of hsa-mir-499 include IL-17Rβ, IL-23α, IL-2R, IL-6, IL-2 and IL-18R. IL-6 activates the production of CRP (C-reactive protein) and fibrinogen through the liver and IL-17Rβ, IL-23α, IL-2R, IL-6, IL-2 and IL-18R contribute to the progress and pathogenesis of RA (8). Findings of recent studies have shown that the rs3746444 polymorphism in the pre-miR-499 is correlated with several diseases, including breast cancer (13), cervical squamous cell carcinoma (CSCC) (14), hepatocellular carcinoma (15), RA (8), coronary artery disease (CAD) (16), chronic obstructive pulmonary disease (COPD) (17) and tuberculosis (17).

More recently the miRNA hsa-mir-146a has also received considerable attention, as it was reported to be overexpressed in synovial fibroblasts, synovial tissue, synovial fluid monocytes, peripheral blood mononuclear cells (PBMCs) and serum plasma of RA patients (18). This polymorphism was principally studied for its association with several diseases, including psoriatic arthritis (19), multiple sclerosis (MS) (20), tuberculosis (17), ulcerative colitis, RA (8,21), SLE (16) and various types of cancer (2229).

Overall, these two single nucleotide polymorphisms (SNPs; rs3746444 and rs2910164) are located at the pre-miRNA regions of hsa-mir-499 and hsa-mir-146a (21), respectively. Given the evidence that SNPs located in the mature miRNA regions affect binding to target mRNAs and the pre-miRNA maturation process (30), the aim of the present study was to evaluate the impact of the rs3746444 and rs2910164 polymorphisms on risk of RA in a sample of the Iranian population.

Materials and methods

Patients

We evaluated the possible association between polymorphisms of hsa-mir-146a and hsa-mir-499 genes (rs2910164 G/C and rs3746444 T/C, respectively) and RA susceptibility in 104 patients meeting the American College of Rheumatology criteria for RA (31). The patients were selected from the Rheumatology Clinic at Zahedan University of Medical Sciences (4,32,33). The control group involved 110 healthy individuals with no relationship to RA patients. The Ethics Committee of Zahedan University of Medical Sciences approved the project and informed consent was obtained from all patients and healthy individuals. Genomic DNA was extracted from peripheral blood samples as previously described (33).

Tetra amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR)

T-ARMS-PCR is a simple and rapid method with a high level of accuracy for the detection of SNPs (3436). This system was used for genotyping of the rs2910164 G/C and rs3746444 T/C polymorphisms. Genotyping of rs2910164 and rs3746444 was performed using two outer primers (FO and RO) and two inner allele-specific primers (FI and RI) for each SNP, as listed in Table I. PCR was performed using commercially available PCR premix (AccuPower PCR PreMix; Bioneer, Daejeon, South Korea) according to the manufacturer’s instructions. The PCR cycling conditions were 95°C for 5 min followed by 30 cycles of 30 sec at 95°C, 25 sec at 61°C for rs2910164, 27 sec at 60°C for rs3746444 and 25 sec at 72°C, with a final extension of 72°C for 10 min. The PCR products were verified on 2% agarose gels containing 0.5 μg/ml ethidium bromide and observed under UV light. The product sizes for rs2910164 were 169 bp for the C allele and 249 bp for the G allele, while the product size for the two outer primers (control band) was 364 bp (Fig. 1). The amplicon sizes for the rs3746444 were 422 bp for the control band, 206 bp for the C allele and 268 bp for the T allele (Fig 2). To ensure genotyping quality, we regenotyped 20% of the random samples and found no genotyping errors.

Table I

Primer sequences for the detection of hsa-mir-146a and hsa-miR-499 gene polymorphisms.

Table I

Primer sequences for the detection of hsa-mir-146a and hsa-miR-499 gene polymorphisms.

GenePrimerSequence (5′-3′)Amplicon size (bp)
hsa-mir-146a; rs2910164 G>CFO GGCCTGGTCTCCTCCAGATGTTTAT364
RO ATACCTTCAGAGCCTGAGACTCTGCC364
FI (C allele) ATGGGTTGTGTCAGTGTCAGACGTC169
RI (G allele) GATATCCCAGCTGAAGAACTGAATTTGAC249
hsa-miR-499; rs3746444 T>CFO GAGTGACCAGGCCCCTTGTCTCTATTAG422
RO TTGCTCTTTCACTCTCATTCTGGTGATG422
FI (C allele) ATGTTTAACTCCTCTCCACGTGACCG206
RI (T allele) GGGAAGCAGCACAGACTTGCTGTTAT268

[i] FO, forward outer; RO, reverse outer; FI, forward inner; RI, reverse inner.

Statistical analysis

Statistical analysis was calculated using SPSS 18 software. Data were analyzed by independent sample t-test and χ2 test. The association between genotypes of hsa-mir-146a and hsa-mir-499 genes and RA were assessed by computing the odds ratio (OR) and 95% confidence intervals (95% CIs) from logistic regression analyses. P<0.05 was considered to indicate a statistically significant difference.

Results

The study group consisted of 104 RA patients (91 females and 13 males) with an average age of 44.7±13.3 years, and 110 healthy subjects (70 females and 40 males) with a mean age of 43.5±10.2 years. No significant difference was found between the groups with respect to age (P=0.458), but a significant difference was observed between the groups with respect to gender (P=0.0001).

The frequency distribution of hsa-mir-499 rs3746444 T/C genotypes in RA patients and normal subjects are demonstrated in Table II. A significant difference was found between case and control groups with regard to rs3746444 T/C polymorphism (χ2=13.32, P=0.001). The hsa-mir-499 rs3746444 T/C polymorphism was a risk factor for predisposition to RA in codominant (TT vs. TC: OR, 2.11; 95% CI, 1.08–4.11; P=0.029; TT vs. CC: OR, 3.88; 95% CI, 1.68–8.98; P=0.002), dominant (TT vs. TC-CC: OR, 2.64; 95% CI, 1.48–4.72; P=0.001) and recessive (TC-CC vs. CC: OR, 3.05; 95% CI, 1.36–6.33; P=0.007) tested inheritance models (Table II). Furthermore, the rs3746444 C allele was identified as a risk factor for susceptibility to RA (OR, 2.49; 95% CI, 1.63–3.81; P<0.0001).

Table II

Frequency distribution of hsa-mir-499 genotypes in RA patients and normal subjects.

Table II

Frequency distribution of hsa-mir-499 genotypes in RA patients and normal subjects.

Modelrs3746444 T>CRA n (%)Control n (%)aOR (95% CI)P-value
CodominantTT46 (44.2)74 (67.3)Ref.-
TC32 (30.8)25 (22.7)2.11 (1.08–4.11)0.029
CC26 (25.0)11 (10.0)3.88 (1.68–8.98)0.002
DominantTT46 (44.2)74 (67.3)Ref.-
TC+CC58 (58.8)36 (32.7)2.64 (1.48–4.72)0.001
RecessiveTT+TC78 (75.0)99 (90.0)Ref.-
CC26 (25.0)11 (10.0)3.05 (1.36–6.83)0.007
AllelesT124 (59.6)173 (78.6)Ref.-
C84 (40.4)47 (21.4)2.49 (1.63–3.81)<0.0001

a Adjusted for gender and age.

{ label (or @symbol) needed for fn[@id='tfn3-mmr-07-01-0287'] } RA, rheumatoid arthritis; OR, odds ratio; CI, confidence interval.

As demonstrated in Table III, the genotypes and allele frequencies of mir-146a rs2910164 were not found to be as significantly different between RA patients and control subjects (χ2=0.348, P=0.841).

Table III

Frequency distribution of hsa-mir-499 genotypes in RA patients and normal subjects.

Table III

Frequency distribution of hsa-mir-499 genotypes in RA patients and normal subjects.

Modelrs3746444 T>CRA n (%)Control n (%)aOR (95%CI)P-value
CodominantGG57 (54.8)64 (59.2)Ref.-
GC39 (37.5)37 (33.6)1.06 (0.58–1.94)0.840
CC8 (7.7)9 (8.2)0.89 (0.31–2.58)0.835
DominantGG57 (54.8)64 (58.2)Ref.-
GC+CC47 (45.2)46 (41.8)1.03 (0.58–1.81)0.918
RecessiveGG+GC96 (92.3)101 (91.8)Ref.-
CC8 (7.7)9 (8.2)0.87 (0.31–2.46)0.796
AllelesG139 (71.6)165 (75.0)Ref.-
C55 (28.4)55 (28.4)55 (28.4)0.504

a Adjusted for gender and age.

{ label (or @symbol) needed for fn[@id='tfn5-mmr-07-01-0287'] } RA, rheumatoid arthritis; OR, odds ratio; CI, confidence interval.

Discussion

In the present study, we analyzed the correlation between genetic polymorphisms in hsa-mir-146a rs2910164 and hsa-mir-499 rs3746444 and susceptibility to RA in a sample of the Iranian population. The hsa-mir-499 rs3746444 polymorphism was revealed to be associated with an overall increased risk of RA in codominant, dominant and recessive tested inheritance models. The prevalence of rs3746444 TC (30.8%) and CC (25%) variants in RA patients were identified as significantly higher than that in the healthy individuals (22.7 and 10%, respectively) and the C allele (minor allele) of rs3746444 was found to be as more frequent in patients with RA than that of controls (40.4 vs. 21.4%, respectively). However, no association was detected between the hsa-mir-146a rs2910164 polymorphism and the risk of RA in our population. In contrast to our findings, Yang et al(21) did not detect a significant association between hsa-mir-499 rs3746444 polymorphisms and RA. However, the authors observed that carriers of the CT genotype in rs3746444 had a higher level of anti-cyclic citrullinated protein (CCP) antibody. In agreement with results of the present study, no significant difference was detected between the groups with respect to the hsa-mir-146a rs2910164 polymorphism.

Polymorphisms in miRNA genes may alter a wide spectrum of biological processes by affecting the processing and/or target selection of miRNAs (30). A growing number of studies have revealed that polymorphisms in miRNA target sites affect the pathogenesis of several human diseases, including inflammatory bowel (11) and Crohn’s disease (37), ulcerative colitis (11), psoriasis (38), COPD (39), SLE (40), MS (20) and RA (4144). The most severe consequence of RA is joint damage, which leads to disability, deformity, morbidity and mortality (1,45). The principal benefit of the detection of hsa-mir-146a and hsa-mir-499 in circulating PBMCs is for utilization as biomarkers to monitor the course of the disease, without the difficulty of invasive surgical procedures to obtain joint tissues and cells for miRNA analysis (2).

The polymorphism in the hsa-mir-499 rs3746444 has been reported to have a marked correlation with a variety of diseases including breast cancer (13), CSCC (14), hepatocellular carcinoma (15), RA (8), CAD (16), COPD (17) and tuberculosis (17). In their study, Yang et al have demonstrated that carriers of the heterozygote genotype (CT) of rs3746444 in RA exhibit higher levels of CRP and erythrocyte sedimentation rate compared to the homozygote carriers (CC and TT), indicative of an important role for rs3746444 in the progress and inflammatory reaction of RA (8). Additional investigation by the same group detected no positive correlation between the SNPs (rs3746444 and rs2910164) and RA. Those authors found that carriers of the genotype CT in rs3746444 had a higher level of anti-CCP antibody in RA and that the SNP rs3746444 may be a candidate biomarker for predicting joint damage in RA patients (21). However, no significant association was observed between rs3746444 and risk of several diseases, including SLE (16), schizophrenia (46), asthma (47) and colorectal (32), gallbladder (48), breast (23) and lung cancer (49).

No association was found between rs2910164 and predisposition to RA in our population. This common hsa-mir-146a polymorphism, rs2910164, involves a G>C nucleotide replacement that causes change from a G:U pair to a C:U mismatch in the stem structure of the hsa-mir-146a precursor, which affects the specificity of mature hsa-mir-146a in binding to its targets, resulting in an elevated expression of hsa-mir-146a (5). The hsa-mir-146a was found to be upregulated in psoriasis (50) and circulating PBMCs of RA patients (18), but is downregulated in SLE (50). Hsa-mir-146a binds several targets, including IRAK2, FADD, IRF-5, Stat-1, PTC1 and FAF1, highlighting the important role of this miRNA in inflammation and apoptosis processes (5).

In conclusion, the present study has shown a marked correlation between the hsa-mir-499 rs3746444 polymorphism and susceptibility to RA in a sample of the Iranian population. However, no association was revealed between the hsa-mir-146a rs2910164 variant and RA susceptibility. Consistent with growing evidence, the present study has demonstrated that miRNA polymorphisms may be suitable for use as diagnostic biomarkers for RA in future.

Acknowledgements

This study was partly supported by a research grant from the Zahedan University of Medical Sciences. The authors would like to thank all subjects who willingly participated in the study.

References

1 

Perricone C, Ceccarelli F and Valesini G: An overview on the genetic of rheumatoid arthritis: a never-ending story. Autoimmun Rev. 10:599–608. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Ceribelli A, Nahid MA, Satoh M and Chan EK: MicroRNAs in rheumatoid arthritis. FEBS Lett. 585:3667–3674. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Tobon GJ, Youinou P and Saraux A: The environment, geo-epidemiology, and autoimmune disease: rheumatoid arthritis. J Autoimmun. 35:10–14. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Hashemi M, Moazeni-Roodi AK, Fazaeli A, et al: The L55M polymorphism of paraoxonase-1 is a risk factor for rheumatoid arthritis. Genet Mol Res. 9:1735–1741. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Chatzikyriakidou A, Voulgari PV, Georgiou I and Drosos AA: miRNAs and related polymorphisms in rheumatoid arthritis susceptibility. Autoimmun Rev. 11:639–641. 2012.

6 

Hua Z, Chun W and Fang-Yuan C: MicroRNA-146a and hemopoietic disorders. Int J Hematol. 94:224–229. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Roy S and Sen CK: MiRNA in innate immune responses: novel players in wound inflammation. Physiol Genomics. 43:557–565. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Yang B, Chen J, Li Y, et al: Association of polymorphisms in pre-miRNA with inflammatory biomarkers in rheumatoid arthritis in the Chinese Han population. Hum Immunol. 73:101–106. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Stein MT, Elias ER, Saenz M, Pickler L and Reynolds A: Autistic spectrum disorder in a 9-year-old girl with macrocephaly. J Dev Behav Pediatr. 31:632–634. 2010.PubMed/NCBI

10 

Sonkoly E, Ståhle M and Pivarcsi A: MicroRNAs: novel regulators in skin inflammation. Clin Exp Dermatol. 33:312–315. 2008. View Article : Google Scholar

11 

Zwiers A, Kraal L, van de Pouw Kraan TC, Wurdinger T, Bouma G and Kraal G: Cutting edge: a variant of the IL-23R gene associated with inflammatory bowel disease induces loss of microRNA regulation and enhanced protein production. J Immunol. 188:1573–1577. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Murata K, Yoshitomi H, Tanida S, et al: Plasma and synovial fluid microRNAs as potential biomarkers of rheumatoid arthritis and osteoarthritis. Arthritis Res Ther. 12:R862010. View Article : Google Scholar : PubMed/NCBI

13 

Hu Z, Liang J, Wang Z, et al: Common genetic variants in pre-microRNAs were associated with increased risk of breast cancer in Chinese women. Hum Mutat. 30:79–84. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Zhi H, Wang L, Ma G, et al: Polymorphisms of miRNAs genes are associated with the risk and prognosis of coronary artery disease. Clin Res Cardiol. 101:289–296. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Xiang Y, Fan S, Cao J, Huang S and Zhang LP: Association of the microRNA-499 variants with susceptibility to hepatocellular carcinoma in a Chinese population. Mol Biol Rep. 39:7019–7023. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Zhang J, Yang B, Ying B, et al: Association of pre-microRNAs genetic variants with susceptibility in systemic lupus erythematosus. Mol Biol Rep. 38:1463–1468. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Li D, Wang T, Song X, et al: Genetic study of two single nucleotide polymorphisms within corresponding microRNAs and susceptibility to tuberculosis in a Chinese Tibetan and Han population. Hum Immunol. 72:598–602. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Pauley KM, Satoh M, Chan AL, Bubb MR, Reeves WH and Chan EK: Upregulated miR-146a expression in peripheral blood mononuclear cells from rheumatoid arthritis patients. Arthritis Res Ther. 10:R1012008. View Article : Google Scholar : PubMed/NCBI

19 

Chatzikyriakidou A, Voulgari PV, Georgiou I and Drosos AA: The role of microRNA-146a (miR-146a) and its target IL-1R-associated kinase (IRAK1) in psoriatic arthritis susceptibility. Scand J Immunol. 71:382–385. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Fenoglio C, Cantoni C, De Riz M, et al: Expression and genetic analysis of miRNAs involved in CD4+ cell activation in patients with multiple sclerosis. Neurosci Lett. 504:9–12. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Yang B, Zhang JL, Shi YY, et al: Association study of single nucleotide polymorphisms in pre-miRNA and rheumatoid arthritis in a Han Chinese population. Mol Biol Rep. 38:4913–4919. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Akkiz H, Bayram S, Bekar A, Akgollu E, Uskudar O and Sandikci M: No association of pre-microRNA-146a rs2910164 polymorphism and risk of hepatocellular carcinoma development in Turkish population: a case-control study. Gene. 486:104–109. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Catucci I, Yang R, Verderio P, et al: Evaluation of SNPs in miR-146a, miR196a2 and miR-499 as low-penetrance alleles in German and Italian familial breast cancer cases. Hum Mutat. 31:E1052–1057. 2010. View Article : Google Scholar : PubMed/NCBI

24 

George GP, Gangwar R, Mandal RK, Sankhwar SN and Mittal RD: Genetic variation in microRNA genes and prostate cancer risk in North Indian population. Mol Biol Rep. 38:1609–1615. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Guo H, Wang K, Xiong G, et al: A functional variant in microRNA-146a is associated with risk of esophageal squamous cell carcinoma in Chinese Han. Fam Cancer. 9:599–603. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Jazdzewski K, Liyanarachchi S, Swierniak M, et al: Polymorphic mature microRNAs from passenger strand of pre-miR-146a contribute to thyroid cancer. Proc Natl Acad Sci USA. 106:1502–1505. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Liu Z, Li G, Wei S, et al: Genetic variants in selected pre-microRNA genes and the risk of squamous cell carcinoma of the head and neck. Cancer. 116:4753–4760. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Min KT, Kim JW, Jeon YJ, et al: Association of the miR-146aC>G, 149C>T, 196a2C>T, and 499A>G polymorphisms with colorectal cancer in the Korean population. Mol Carcinog. Dec 7–2011.(Epub ahead of print).

29 

Mittal RD, Gangwar R, George GP, Mittal T and Kapoor R: Investigative role of pre-microRNAs in bladder cancer patients: a case-control study in North India. DNA Cell Biol. 30:401–406. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Duan R, Pak C and Jin P: Single nucleotide polymorphism associated with mature miR-125a alters the processing of pri-miRNA. Hum Mol Genet. 16:1124–1131. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Arnett FC, Edworthy SM, Bloch DA, et al: The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31:315–324. 1988. View Article : Google Scholar : PubMed/NCBI

32 

Sandoughi M, Fazaeli A, Bardestani G and Hashemi M: Frequency of HLA-DRB1 alleles in rheumatoid arthritis patients in Zahedan, southeast Iran. Ann Saudi Med. 31:171–173. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Hashemi M, Moazeni-Roodi AK, Fazaeli A, et al: Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran. Genet Mol Res. 9:333–339. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Hashemi M, Moazeni-Roodi A, Bahari A and Taheri M: A tetra-primer amplification refractory mutation system-polymerase chain reaction for the detection of rs8099917 IL28B genotype. Nucleosides Nucleotides Nucleic Acids. 31:55–60. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Hashemi M, Eskandari-Nasab E, Fazaeli A, et al: Association of genetic polymorphisms of glutathione-S-transferase genes (GSTT1, GSTM1, and GSTP1) and susceptibility to nonalcoholic fatty liver disease in Zahedan, southeast Iran. DNA Cell Biol. 31:672–677. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Hashemi M, Hoseini H, Yaghmaei P, et al: Association of polymorphisms in glutamate-cysteine ligase catalytic subunit and microsomal triglyceride transfer protein genes with nonalcoholic fatty liver disease. DNA Cell Biol. 30:569–575. 2011. View Article : Google Scholar

37 

Chatzikyriakidou A, Voulgari PV, Georgiou I and Drosos AA: A polymorphism in the 3′-UTR of interleukin-1 receptor-associated kinase (IRAK1), a target gene of miR-146a, is associated with rheumatoid arthritis susceptibility. Joint Bone Spine. 77:411–413. 2010.

38 

Wu LS, Li FF, Sun LD, et al: A miRNA-492 binding-site polymorphism in BSG (basigin) confers risk to psoriasis in central south Chinese population. Hum Genet. 130:749–757. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Adcock IM, Caramori G and Barnes PJ: Chronic obstructive pulmonary disease and lung cancer: new molecular insights. Respiration. 81:265–284. 2011. View Article : Google Scholar : PubMed/NCBI

40 

Brest P, Lapaquette P, Souidi M, et al: A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn’s disease. Nat Genet. 43:242–245. 2011.PubMed/NCBI

41 

Apparailly F: Looking for microRNA polymorphisms as new rheumatoid arthritis risk loci? Joint Bone Spine. 77:377–379. 2010. View Article : Google Scholar : PubMed/NCBI

42 

Glinsky GV: Disease phenocode analysis identifies SNP-guided microRNA maps (MirMaps) associated with human ‘master’ disease genes. Cell Cycle. 7:3680–3694. 2008.PubMed/NCBI

43 

Glinsky GV: SNP-guided microRNA maps (MirMaps) of 16 common human disorders identify a clinically accessible therapy reversing transcriptional aberrations of nuclear import and inflammasome pathways. Cell Cycle. 7:3564–3576. 2008. View Article : Google Scholar

44 

Zhao ZZ, Croft L, Nyholt DR, et al: Evaluation of polymorphisms in predicted target sites for micro RNAs differentially expressed in endometriosis. Mol Hum Reprod. 17:92–103. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Egerer K, Feist E and Burmester GR: The serological diagnosis of rheumatoid arthritis: antibodies to citrullinated antigens. Dtsch Arztebl Int. 106:159–163. 2009.PubMed/NCBI

46 

Zou M, Li D, Lv R, et al: Association between two single nucleotide polymorphisms at corresponding microRNA and schizophrenia in a Chinese population. Mol Biol Rep. 39:3385–3391. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Okubo M, Tahara T, Shibata T, et al: Association study of common genetic variants in pre-microRNAs in patients with ulcerative colitis. J Clin Immunol. 31:69–73. 2011. View Article : Google Scholar : PubMed/NCBI

48 

Okubo M, Tahara T, Shibata T, et al: Association between common genetic variants in pre-microRNAs and gastric cancer risk in Japanese population. Helicobacter. 15:524–531. 2010. View Article : Google Scholar : PubMed/NCBI

49 

Tian T, Shu Y, Chen J, et al: A functional genetic variant in microRNA-196a2 is associated with increased susceptibility of lung cancer in Chinese. Cancer Epidemiol Biomarkers Prev. 18:1183–1187. 2009. View Article : Google Scholar : PubMed/NCBI

50 

Li L, Chen XP and Li YJ: MicroRNA-146a and human disease. Scand J Immunol. 71:227–231. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January 2013
Volume 7 Issue 1

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Hashemi, M., Eskandari-Nasab, E., Zakeri, Z., Atabaki, M., Bahari, G., Jahantigh, M. ... Ghavami, S. (2013). Association of pre-miRNA-146a rs2910164 and pre‑miRNA-499 rs3746444 polymorphisms and susceptibility to rheumatoid arthritis. Molecular Medicine Reports, 7, 287-291. https://doi.org/10.3892/mmr.2012.1176
MLA
Hashemi, M., Eskandari-Nasab, E., Zakeri, Z., Atabaki, M., Bahari, G., Jahantigh, M., Taheri, M., Ghavami, S."Association of pre-miRNA-146a rs2910164 and pre‑miRNA-499 rs3746444 polymorphisms and susceptibility to rheumatoid arthritis". Molecular Medicine Reports 7.1 (2013): 287-291.
Chicago
Hashemi, M., Eskandari-Nasab, E., Zakeri, Z., Atabaki, M., Bahari, G., Jahantigh, M., Taheri, M., Ghavami, S."Association of pre-miRNA-146a rs2910164 and pre‑miRNA-499 rs3746444 polymorphisms and susceptibility to rheumatoid arthritis". Molecular Medicine Reports 7, no. 1 (2013): 287-291. https://doi.org/10.3892/mmr.2012.1176