Open Access

SM‑164 enhances the antitumor activity of adriamycin in human U2‑OS cells via downregulation of X‑linked inhibitor of apoptosis protein

  • Authors:
    • Jiangwei Chen
    • Xuanyin Chen
    • Xiaodong Chen
    • Haiying Sun
    • Dong Yang
  • View Affiliations

  • Published online on: April 22, 2019     https://doi.org/10.3892/mmr.2019.10181
  • Pages: 5079-5086
  • Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The antitumor effects of SM‑164 and adriamycin (ADM) on human osteosarcoma U2‑OS cells, the underlying mechanism are yet to be investigated. In the present study, U2‑OS cells were divided into control, ADM, SM‑164, and ADM + SM‑164 groups. In addition, cells treated with both SM‑164 and ADM were further divided into three subgroups: SM‑164 + ADM, SM‑164 + ADM + vector and SM‑164 + ADM + X‑linked inhibitor of apoptosis protein (XIAP) silencing groups. XIAP expression was achieved via transfection with shRNA lentiviral vectors. Reverse transcription‑quantitative polymerase chain reaction and western blotting were used to detect the expression of caspases‑7, ‑9, and ‑3, poly ADP‑ribose polymerase (PARP), XIAP, cellular inhibitor of apoptosis protein‑1 (cIAP‑1) and survivin. Cell viability and apoptosis were evaluated using MTT and flow cytometry assays, respectively. Compared with the control group, cell viability decreased, while apoptosis was increased in the ADM and SM‑164‑treatment group. ADM and SM‑164 treatment promoted the expression of caspases‑7, ‑9 and ‑3, and PARP, but reduced the expression of XIAP, survivin and cIAP‑1. Compared with ADM + SM‑164 group, XIAP silencing with ADM + SM‑164 treatment further reduced cell viability, promoted apoptosis, increased caspase‑7, ‑9 and ‑3, and PARP expression; however the expression of survivin and cIAP‑1 were reduced. Combined ADM and SM‑164 treatment may be considered as potential therapeutic agent in the treatment of osteosarcoma, possibly via reductions XIAP expression.

Introduction

Osteosarcoma (OS) is one of the most common types of primary malignant bone tumors, accounting for 60% of malignant bone tumors in adolescents (1). The management of OS remains challenging, particularly under conditions of metastases, and is often complicated by local recurrence following treatment. With continuing developments in adjuvant chemotherapy (2) and improvements in surgical techniques, the 5-year survival rates have risen from <20% to ~60–80% (3); however, distant metastases may occur at early stages of the condition, while recurrence is often detected without distant metastases (4). For such patients, treatment outcomes remain poor (4)

Adriamycin (ADM) is an important chemotherapeutic agent used in the treatment of OS. ADM affects the structure and function of DNA via intercalation, prevents DNA replication and RNA synthesis, and induces apoptosis in tumor cells (5). As ADM possesses a narrow therapeutic index, severe cardiotoxicity and bone marrow suppression are common side effects of treatment (6). SM-164 is a novel non-peptide, symmetric alkyne small molecule. The binding capacity of SM-164 to the baculovirus inhibitor of apoptosis protein repeat (BIR) domain is ~300–7,000 times that of monovalent Smac mimetics and of the AVPI peptide of wild Smac (7). SM-164 notably induces apoptosis in Smac-sensitive tumor cells without inflicting marked toxicity to normal cells (8). Its key mechanism of action involves the inhibition of the X-linked inhibitor of apoptosis protein (XIAP) (9).

The family of inhibitor of apoptosis (IAP) proteins contains some of the most important apoptosis inhibitors, including XIAP, cellular inhibitor of apoptosis protein (cIAP)-1 and −2, neuronal apoptosis inhibitor protein, survivin, livin/melanoma-IAP and apollon, all of which mainly inhibit caspase activity and the induction of the apoptotic pathway (10). Overexpression of IAPs has been reported in a variety of tumor cells, and is an important cause of tumor cell apoptosis and chemoresistance (1113). At present, XIAP is the most potent known member of IAPs, while survivin has a strong inhibitory effect on apoptosis (14).

The present study investigated how combined SM-164 and ADM treatment, as well as XIAP silencing, affected U2-OS cells. The results may provide insight for the development of novel chemotherapeutic and genetic treatment strategies in the management of OS.

Materials and methods

Cell cultures

U2-OS cells were purchased from The Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Beijing, China) and cultured in RPMI-1640 (KGM31800S-500; Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). The culture was supplemented with 10% fetal bovine serum (FBS; cat. no. 04-007-1A; Biological Industries USA, Inc., Cromwell, CT, USA) and 100 U/ml penicillin-streptomycin (cat. no. P1400; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) in 5% CO2 at 37°C. Cells that were 70% confluent were used in experiments.

Cultured cells were divided into four groups: Control, ADM, SM-164 (200 nM), and combined treatment (0.5 µg/ml ADM + 200 nM SM-164). Following the addition of ADM into cell media for 2 h at 37°C, cells were washed and then treated with SM-164 (200 nM) for 24 h at 37°C.

MTT assay

Cells (3×103/ml) were seeded in 96-well plates. After the indicated treatments, an MTT assay was applied to evaluate cell viability as previously described (15). The optical density (OD) was determined via a microplate reader (Bio-Tek Instruments, Inc., Winooski, VT, USA) at 570 nm and represented cell viability.

Flow cytometry

Following the indicated treatments, U2-OS cells were collected after trypsin digestion (0.25%, 2 min at 37°C) and underwent centrifugation (780 × g for 3 min at room temperature); 5 µl of Annexin V-fluorescein isothiocyanate and 5 µl propidium iodide were subsequently added to each tube for 5 min at room temperature. After light mixing, apoptosis was detected within 1 h by FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) and analyzed by FlowJo version 10 (FlowJo LLC, Ashland, OR, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Following the indicated treatments, U2-OS cells were collected after trypsin digestion (0.25%, 2 min at 37°C). Total RNA was extracted with a TRIzol (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Subsequently, RNA was amplified using a one-step RT-PCR kit (cat. no. 00081405; CWBIO, Taizhou, China). Primers were added into a 25-µl ULtraSYBR Mixture (cat. no. 01170; CWBIO, Beijing, China). qPCR was conducted as follows using an Applied Biosystems 7500 (Thermo Fisher Scientific, Inc.) for 6 repeats: 95°C denaturation for 10 sec, 56°C annealing for 30 sec, and 72°C extension for 30 sec (40 cycles). The primer sequences were listed in Table I. The quantification cycle value for each gene was detected and the expression levels of target genes were calculated using the 2−ΔΔCq method (16,17).

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GenesPrimers (5′-3′)
cIAP-1-F CTCGTGGAGTGGAAGACA
cIAP-1-R GGAGTGATCGTGGTAAGG
XIAP-F TGTGGGAAACAGAAATCA
XIAP-R GGGCTTAAATGGGCATAG
GAPDH-F GAAGGTCGGAGTCAACGGAT
GAPDH-R CCTGGAAGATGGTGATGGG

[i] cIAP, cellular inhibitor of apoptosis protein 1; F, forward; R, reverse; XIAP, X-linked inhibitor of apoptosis protein.

Western blot analysis

Protein was extracted from cells for western blotting using a protein isolation kit according to the manufacturer's protocols (cat. no. C1053; Applygen Technologies Inc., Beijing, China) and concentrations were determined using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). SDS-PAGE (12%) was used to separate 25 µg of protein from each group. Samples were then transferred onto nitrocellulose membranes for western blot analysis. After a 2-h blocking in 5% bovine serum albumin (BSA) at room temperature, membranes were incubated with the following primary antibodies: Anti-GAPDH (1/2,000; TA-08; OriGene Technologies, Inc., Beijing, China); anti-caspase 7 (1/2,000; ab25900; Abcam, Cambridge, UK); anti-active caspase 9 (1/5,000; ab2324, Abcam); anti-active caspase 3 (1/10,000; ab2302; Abcam); anti-poly (ADP-ribose) polymerase (PARP; 1/5,000; ab32138; Abcam); anti-XIAP (1/500; bs-1281R; BIOSS, Beijing, China); anti-cIAP1 (1/5,000; ab108361; Abcam) and anti-survivin (1/5,000; ab76424; Abcam). Following incubation with primary antibodies at 4°C overnight, nitrocellulose membranes were washed three times and incubated with a secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG; cat. no. A16104SAMPLE; Thermo Fisher Scientific, Inc.) at 4°C for 2 h. Bands were visualized using an enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.). Blot densities were quantified using Quantity One software (v4.62; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

XIAP silencing

Short hairpin RNA (shRNA) was used to silence the expression of XIAP; the sequences were: Forward 5′-CACCCATGCAGCTGTAGATAGATGGCAATCGAAATTGCCATCTATCTACA-3′ and reverse, 5′-AAAACATGCAGCTGTAGATAGATGGCAATTTCGATTGCCATCTATCTACA-3′ (Sangon Biotech Co., Ltd., Shanghai, China). After annealing the double chain DNA at 56°C for 30 sec, the sequences were integrated into the lentiviral skeleton carrier PDS019_pL_shRNA_F (Shanghai Novobio Co., Ltd., Shanghai, China). Recombinant lentiviral plasmid liposomes (Invitrogen; Thermo Fisher Scientific, Inc.) were transfected into 293T cells (American Type Culture Collection, Manassas, VA, USA) to produce recombinant lentivirus PDS019-PL-shRNA-GFP-homo- XIAP. Viral replication was detected by fluorescence microscopy, while the titer was determined to be 1.8×1011 pfu/ml according to a 50% tissue culture infective dose method (18). Cells (1×105/ml) were seeded in 96-well plates. The lentivirus was applied for transfection 24 h later. On the second day, 2 ml of original medium (RPMI-1640) was replaced with medium containing 6 mg/ml Polybrene. An appropriate amount of viral suspension was added. After 4 h, 2 ml of fresh medium was added to dilute the Polybrene. Fresh medium was added 2 h later.

U2-OS cells were treated with 0.5 µg/ml ADM + 200 nM SM-164 as aforementioned. Following the addition of ADM into cellular media for 2 h, cells were washed with PBS and treated with SM-164 (200 nM). Cells were further divided into three groups after 24 h: ADM + SM-164, ADM + SM-164 + vector (empty), and ADM + SM-164 + shRNA-XIAP (sh-XIAP) groups. MTT, RT-qPCR and western blotting were performed as aforementioned 24 h after transfection.

Statistical analysis

All numerical data from six repeated experiments were expressed as the mean ± standard deviation. Statistical analyses were performed using one-way analysis of variance followed by a Bonferroni post-hoc test. Analysis was conducted using SPPS software version 17 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Combination of SM-164 with ADM reveals enhanced inhibition of cell viability

As presented in Fig. 1, the OD values of the groups respectively treated with ADM and SM-164 were significantly decreased compared with the control group; the OD value decreased further in the combined treatment group. These data suggest that a combination of SM-164 and ADM reveals enhanced inhibition of cell viability compared with single application of SM-164 or ADM.

Combined SM-164 and ADM enhances apoptosis

As presented in Fig. 2, the apoptosis of cells treated with ADM or SM-164 alone increased significantly compared with the control group, but was significantly reduced than under conditions of combined treatment. These data suggest that combination of SM-164 with ADM reveals enhanced apoptosis compared with single application of SM-164 or ADM.

Combined SM-164 and ADM treatment exhibits enhanced effects on caspases-7, −9, −3, PARP, survivin and cIAP-1 expression

The mRNA expression levels of XIAP, cIAP-1 and survivin were significantly decreased following ADM or SM-164 treatment alone; however, expression was significantly increased compared with combined treatment (Fig. 3A). In addition, the protein expression levels of caspases-7, −9, and-3, and PARP increased significantly, while that of XIAP, survivin and cIAP-1 decreased significantly in groups treated with ADM or SM-164, compared with the control. Of note, the expression of these proteins was significantly upregulated following treatment with ADM or SM-164 compared with combined treatment (Fig. 3B and C). These data suggest that combination of SM-164 and ADM demonstrates increased effects on apoptosis-related protein expression compared with single application of SM-164 or ADM.

Silencing of XIAP further suppresses viability and promotes apoptosis

As presented in Fig. 4A, cells in the vector and XIAP-silencing groups were successfully transfected. The expression of XIAP in the sh-XIAP group was significantly reduced at the mRNA and protein levels than in the ADM + SM-164 group (P<0.05; (Fig. 4B-D).

As presented in Fig. 5, the OD value of the ADM + SM-164 + XIAP silencing group decreased significantly, and the difference was statistically significant compared with the ADM + SM-164 group (P<0.05). As shown in Fig. 6, the number of apoptotic cells in the ADM + SM-164 + XIAP silencing group increased significantly; the difference was statistically significant compared with the ADM + SM-164 group (P<0.05). These data suggest that silencing of XIAP further suppresses viability and promotes apoptosis compared with SM-164 treatment.

Effects XIAP silencing on caspases-7, −9 and −3, PARP, survivin and cIAP-1 expression

As shown in Fig. 7A, compared with the ADM + SM-164 group, the mRNA expression levels of survivin and cIAP-1 were significantly lower. In addition, the protein expression levels of caspases-7, −9, and −3, and PARP in the ADM + SM-164 + XIAP silencing group were significantly increased compared with the ADM + SM-164 group; the expression of cIAP-1 and survivin were also downregulated (P<0.05; Fig. 7B and C). These data suggest that silencing of XIAP further promotes apoptosis-related protein expression compared with SM-164 treatment.

Discussion

Neoadjuvant chemotherapy can induce primary tumor necrosis, facilitate surgical resection and eliminate micrometastases (19). The main anticancer effect of ADM has been reported to involve the inhibition of topoisomerase II and reduced DNA stability caused by free radicals (2022). SM-164 can combine with IAPs, promote the rapid degradation of cIAP-1, and effectively interfere with the inhibition caspases-9, −3 and −7 mediated by of XIAP. SM-164 is an effective inducer of apoptosis in tumor cells and xenotransplanted tissues (9). The results of the present study revealed that SM-164 and ADM suppressed the viability of U2-OS cells, with combined SM-164 and ADM treatment exhibiting a synergistic pharmacological effect. In addition, we reported SM-164 and ADM to promote the apoptosis of U2-OS cells, and that combined use of the two drugs further increased apoptosis.

IAPs mainly inhibit caspases, inactivate apoptosis pathways, and interfere in cell apoptosis (11). IAPs can inhibit the caspase-dependent apoptosis pathway by combining with caspases-3, −7 and −9; IAPs have become ideal target proteins for altering drug resistance of several key chemotherapeutic drugs (23). ADM can act in concert with survivin (and other IAP family proteins) in most tumor cells via downregulation of IAP anti-apoptotic factors; thus, the mitochondrial pathway of tumor cell apoptosis may be induced (11). SM-164 is a Smac protein small molecule mimic. In a variety of tumor cells expressing IAPs, caspases-9 and −3 are activated to inhibit the apoptosis of tumor cells (24). SM-164 is able to enhance the antitumor effects of ADM and reduce toxicity to normal cells (8). SM-164 can stimulate Smac protein to initiate apoptotic signaling pathways and further alleviate the inhibitory effects of IAPs to its effectors (caspases-3 and −7, and the apoptosis-initiating factor caspase-9), which mediates a caspase cascade reaction to induce U2-OS cell apoptosis (25).

Our results revealed that treatment with ADM and SM-164 alone significantly increased the expression of apoptosis-associated factors including caspases-3, −7 and −9. The expression of anti-apoptotic factors, such as XIAP, cIAP and survivin were also reported to be decreased; combined drug treatment was observed to be the most effective. This is also consistent with the results of a recent study (24). XIAP is the most potent caspase inhibitor in the IAP family of proteins, possessing three BIR domains at its N-terminal, which can regulate the death-receptor pathway and mitochondrial pathway-dependent apoptosis (26). BIR domain 3 in XIAP can effectively inhibit the activity of caspase-9 (27). The association between BIR1 and BIR2 can selectively inhibit caspases-3 and −7 (28).

Furthermore, the results of the present study demonstrated that XIAP silencing inhibited cell viability and increased apoptosis. Our findings also revealed that silencing XIAP suppressed the expression of cIAP and survivin, yet the expression of caspases-3, −7 and −9 were upregulated. Therefore, XIAP may serve a regulatory role in tumor cell apoptosis. ADM and SM-164 were reported to inhibit cell viability and promote apoptosis, which could possibly occur via XIAP downregulation. These results suggest the potential application of this combined treatment in clinical settings; however, further investigation is required. Our future studies aim to confirm these findings using a XIAP overexpression vector. Overexpression of XIAP may provide insight into the combined effects of ADM + SM-164 as a potential treatment of OS.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81460406 and 81760488).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JC, XuC, XiC and HS performed the experiments and analyzed the data. DY designed the study and wrote the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wang LL: Biology of osteogenic sarcoma. Cancer J. 11:294–305. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Ryu K, Susa M, Choy E, Yang C, Hornicek FJ, Mankin HJ and Duan Z: Oleanane triterpenoid CDDO-Me induces apoptosis in multidrug resistant osteosarcoma cells through inhibition of Stat3 pathway. BMC Cancer. 10:1872010. View Article : Google Scholar : PubMed/NCBI

3 

Ramakrishnan V, Painuly U, Kimlinger T, Haug J, Rajkumar SV and Kumar S: Inhibitor of apoptosis proteins as therapeutic targets in multiple myeloma. Leukemia. 28:1519–1528. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Du C, Fang M, Li Y, Li L and Wang X: Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell. 102:33–42. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Yao C, Wu S, Li D, Ding H, Wang Z, Yang Y, Yan S and Gu Z: Co-administration phenoxodiol with doxorubicin synergistically inhibit the activity of sphingosine kinase-1 (SphK1), a potential oncogene of osteosarcoma, to suppress osteosarcoma cell growth both in vivo and in vitro. Mol Oncol. 6:392–404. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Chatterjee K, Zhang J, Honbo N and Karliner JS: Doxorubicin cardiomyopathy. Cardiology. 115:155–162. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Sun H, Nikolovska-Coleska Z, Lu J, Meagher JL, Yang CY, Qiu S, Tomita Y, Ueda Y, Jiang S, Krajewski K, et al: Design, synthesis, and characterization of a potent, nonpeptide, cell-permeable, bivalent Smac mimetic that concurrently targets both the BIR2 and BIR3 domains in XIAP. J Am Chem Soc. 129:15279–15294. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Bai L, McEachern D, Yang CY, Lu J, Sun H and Wang S: LRIG1 modulates cancer cell sensitivity to Smac mimetics by regulating TNFα expression and receptor tyrosine kinase signaling. Cancer Res. 72:1229–1238. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Lu J, Bai L, Sun H, Nikolovska-Coleska Z, McEachern D, Qiu S, Miller RS, Yi H, Shangary S, Sun Y, et al: SM-164: A novel, bivalent Smac mimetic that induces apoptosis and tumor regression by concurrent removal of the blockade of cIAP-1/2 and XIAP. Cancer Res. 68:9384–9393. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Silke J and Meier P: Inhibitor of apoptosis (IAP) proteins-modulators of cell death and inflammation. Cold Spring Harb Perspect Biol. 5:2013. View Article : Google Scholar : PubMed/NCBI

11 

Gowda Saralamma VV, Lee HJ, Raha S, Lee WS, Kim EH, Lee SJ, Heo JD, Won C, Kang CK and Kim GS: Inhibition of IAP's and activation of p53 leads to caspase-dependent apoptosis in gastric cancer cells treated with Scutellarein. Oncotarget. 9:5993–6006. 2017.PubMed/NCBI

12 

Werner TA, Nolten I, Dizdar L, Riemer JC, Schütte SC, Verde PE, Raba K, Schott M, Knoefel WT and Krieg A: IAPs cause resistance to TRAIL-dependent apoptosis in follicular thyroid cancer. Endocr Relat Cancer. 25:295–308. 2018. View Article : Google Scholar : PubMed/NCBI

13 

Tamanini E, Buck IM, Chessari G, Chiarparin E, Day JEH, Frederickson M, Griffiths-Jones CM, Hearn K, Heightman TD, Iqbal A, et al: Discovery of a potent nonpeptidomimetic, small-molecule antagonist of cellular inhibitor of apoptosis protein 1 (cIAP1) and X-linked inhibitor of apoptosis protein (XIAP). J Med Chem. 60:4611–4625. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Dizdar L, Oesterwind KA, Riemer JC, Werner TA, Mersch S, Möhlendick B, Schütte SC, Verde PE, Raba K, Topp SA, et al: Preclinical assessment of survivin and XIAP as prognostic biomarkers and therapeutic targets in gastroenteropancreatic neuroendocrine neoplasia. Oncotarget. 8:8369–8382. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Zhu G, Wang X, Wu S and Li Q: Involvement of activation of PI3K/Akt pathway in the protective effects of puerarin against MPP+-induced human neuroblastoma SH-SY5Y cell death. Neurochem Int. 60:400–408. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Zhu G, Li J, He L, Wang X and Hong X: MPTP-induced changes in hippocampal synaptic plasticity and memory are prevented by memantine through the BDNF-TrkB pathway. Br J Pharmacol. 172:2354–2368. 2015. View Article : Google Scholar : PubMed/NCBI

18 

LaBarre DD and Lowy RJ: Improvements in methods for calculating virus titer estimates from TCID50 and plaque assays. J Virol Methods. 96:107–126. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Wittig JC, Bickels J, Priebat D, Jelinek J, Kellar-Graney K, Shmookler B and Malawer MM: Osteosarcoma: A multidisciplinary approach to diagnosis and treatment. Am Fam Physician. 65:1123–1132. 2002.PubMed/NCBI

20 

Gewirtz DA: A critical evaluation of the mechanisms of action proposed for the antitumor effects of the anthracycline antibiotics adriamycin and daunorubicin. Biochem Pharmacol. 57:727–741. 1999. View Article : Google Scholar : PubMed/NCBI

21 

Jung K and Reszka R: Mitochondria as subcellular targets for clinically useful anthracyclines. Adv Drug Deliv Rev. 49:87–105. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Hurley LH: DNA and its associated processes as targets for cancer therapy. Nat Rev Cancer. 2:188–200. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Pilling AB, Hwang O, Boudreault A, Laurent A and Hwang C: IAP antagonists enhance apoptotic response to enzalutamide in castration-resistant prostate cancer cells via autocrine TNF-α signaling. Prostate. 77:866–877. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Yang D, Zhao Y, Li AY, Wang S, Wang G and Sun Y: Smac-mimetic compound SM-164 induces radiosensitization in breast cancer cells through activation of caspases and induction of apoptosis. Breast Cancer Res Treat. 133:189–199. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Jiang J, Yang Z, Fan C, Sun H and Yang D: SMAC mimetic SM-164 enhanced adriamycin induced apoptosis and cell cycle arrest in osteosarcoma cell line HOS. Int J Clin Exp Med. 10:2818–2825. 2017.

26 

Schwerd T, Pandey S, Yang HT, Bagola K, Jameson E, Jung J, Lachmann RH, Shah N, Patel SY, Booth C, et al: Impaired antibacterial autophagy links granulomatous intestinal inflammation in Niemann-Pick disease type C1 and XIAP deficiency with NOD2 variants in Crohn's disease. Gut. 66:1060–1073. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Shiozaki EN, Chai J, Rigotti DJ, Riedl SJ, Li P, Srinivasula SM, Alnemri ES, Fairman R and Shi Y: Mechanism of XIAP-mediated inhibition of caspase-9. Mol Cell. 11:519–527. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Lin YF, Lai TC, Chang CK, Chen CL, Huang MS, Yang CJ, Liu HG, Dong JJ, Chou YA, Teng KH, et al: Targeting the XIAP/caspase-7 complex selectively kills caspase-3-deficient malignancies. J Clin Invest. 123:3861–3875. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

June 2019
Volume 19 Issue 6

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Chen, J., Chen, X., Chen, X., Sun, H., & Yang, D. (2019). SM‑164 enhances the antitumor activity of adriamycin in human U2‑OS cells via downregulation of X‑linked inhibitor of apoptosis protein. Molecular Medicine Reports, 19, 5079-5086. https://doi.org/10.3892/mmr.2019.10181
MLA
Chen, J., Chen, X., Chen, X., Sun, H., Yang, D."SM‑164 enhances the antitumor activity of adriamycin in human U2‑OS cells via downregulation of X‑linked inhibitor of apoptosis protein". Molecular Medicine Reports 19.6 (2019): 5079-5086.
Chicago
Chen, J., Chen, X., Chen, X., Sun, H., Yang, D."SM‑164 enhances the antitumor activity of adriamycin in human U2‑OS cells via downregulation of X‑linked inhibitor of apoptosis protein". Molecular Medicine Reports 19, no. 6 (2019): 5079-5086. https://doi.org/10.3892/mmr.2019.10181