Open Access

Multidrug‑resistant Acinetobacter baumannii strains with NDM‑1: Molecular characterization and in vitro efficacy of meropenem‑based combinations

  • Authors:
    • Jingjing Wang
    • Yongzhong Ning
    • Shu Li
    • Yun Wang
    • Jinhua Liang
    • Chunming Jin
    • Hairun Yan
    • Yongcun Huang
  • View Affiliations

  • Published online on: August 20, 2019     https://doi.org/10.3892/etm.2019.7927
  • Pages: 2924-2932
  • Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Acinetobacter baumannii is an important cause of hospital‑acquired, multidrug‑resistant (MDR) infections occurring worldwide. Anti‑microbial combination regimens may be the only feasible treatment option for affected patients. In the present study, the efficacy of the combined therapy of meropenem with colistin, ampicillin‑sulbactam, tazobactam and vancomycin against clinical strains of MDR A. baumannii was determined. Anti‑microbial susceptibility testing was performed and resistance genes were characterized by a multiplex polymerase chain reaction (PCR)‑reverse line blot assay. The genetic background of New Delhi metallo‑β‑lactamase 1 (NDM‑1) was analysed by primer walking. The presence of NDM‑1 was detected using the modified Hodge test and the EDTA‑combined disk test. To screen for synergistic drug effects, the fractional inhibitory concentration index was calculated using a checkerboard assay. The results of the PCR as well as the sequence analyses suggested that NDM‑1 was located downstream of the ISAba125 element. In addition, a synergistic effect was determined for meropenem + vancomycin, meropenem + tazobactam and meropenem + ampicillin + sulbactam in two strains each, and in four strains for meropenem + colistin. A total of five A. baumannii strains with resistance to numerous antibiotics and carrying numerous resistance genes were identified. In the strains of A. baumannii, the NDM‑1 gene was integrated in a transposon structure with a copy of the ISAba125 insertion sequence. However, the genetic background was not identical among the different species and strains. The genetic variability of NDM‑1 may facilitate the rapid dissemination of this gene. In conclusion, meropenem may enhance the efficacy of antibiotics in A. baumannii strains with NDM‑1‑associated MDR.

Introduction

Acinetobacter baumannii is a significant infectious microbial factor in hospitalized patients throughout the world, and the associated mortality and morbidity have been increasing (1). It is an opportunistic bacterial pathogen, with a major involvement in sepsis, pneumonia, urinary tract infection and primary bacteremia. According to the US National Healthcare Safety Network surveillance data for 2009–2010, A. baumannii caused 1.8% of all healthcare-associated infections (2). Isolates of the strains of A. baumannii with extensive multi-drug resistance (MDR) have raised significant concern. Carbapenem- and colistin-resistant A. baumannii strains are considered an emerging, serious public health problem (3). The emergence of carbapenem resistance genes and β-lactamase gene in A. baumannii has arisen as a significant public health concern (4). The carbapenem-resistant attribute of A. baumannii is principally associated with OXA-type β-lactamases, particularly OXA-23. The development of antibiotic resistance of this species has been associated with the emergence of New Delhi metallo-β-lactamase 1 (NDM-1), the potent carbapenem resistance gene (5). Several distinct species of Enterobacteriaceae have been reported to harbour NDM-1. Studies have reported on A. baumannii with NDM-1 from environmental and clinical isolates in various countries (6,7).

Meropenem is a carbapenem antibiotic with the ability to bind to penicillin-binding proteins and inhibit β-lactamase with the broadest spectrum of activity among β-lactam antibiotics (8). Vancomycin is a glycopeptide antibiotic that is an inhibitor of bacterial peptidoglycan synthesis (9). Colistin is a cationic polypeptide antibiotic with the ability to increase the permeability of the cell membrane, ultimately leading to bacterial death. Tazobactam and sulbactam only inhibit selected class A enzymes, excluding Klebsiella pneumoniae carbapenemase (KPC)-type carbapenemases, generally have a minimal effect on AmpC β-lactamases, and have been reported to exhibit the intrinsic anti-bacterial activity on strains of Acinetobacter at concentrations attainable in the human body (5.5–51 and ~40 mg/l, respectively) (1012).

In another study, the reintroduction of colistin, which is the only remaining active microbial factor with an in vitro anti-bacterial effect on MDR Gram-negative bacteria, has been reported for treating carbapenem-resistant strains of A. baumannii (13). The colistin resistance of A. baumannii strains is well-documented (3), and it is based on the following two mechanisms: Modification of lipid A and lipopolysaccharide loss (14,15). Vancomycin is an inhibitor of bacterial peptidoglycan synthesis, which lacks activity against Gram-negative bacteria due to its large size and hydrophobicity. When colistin was combined with vancomycin, a molecule that should ordinarily have no effect on Gram-negative organisms, due to the relative impermeability of the outer membrane to such a large hydrophobic molecule, a synergistic effect is achieved, and this treatment may become the most common therapy for MDR A. baumannii infections in the future (16).

The present study explored the genetic environment of clinical MDR strains of A. baumannii carrying the NDM-1 gene, and determined the in vitro effects of meropenem in conjunction with colistin, ampicillin-sulbactam, tazobactam as well as vancomycin.

Materials and methods

Bacterial strains and growth conditions

Strains of A. baumannii (n=264) were selected from the pool of clinical isolates from the North of China that were obtained between June 2000 and August 2015. The isolates were obtained from urine (n=55), blood (n=73), bronchoalveolar lavage fluid (n=72), abdominal samples (n=18), cerebrospinal fluid (CSF) (n=29), catheter tips (n=8) and stool specimens (n=9) at hospitals including the Second Affiliated Hospital of Henan University of Science and Technology (Luoyang, China), the Beijing ChuiYangLiu Hospital affiliated to Tsinghua University (Beijing, China), Hongqi Hospital of Mudanjiang Medical College (Mudanjiang, China) and the Second Affiliated Hospital of Mudanjiang Medical College (Mudanjiang, China). Standard strains of A. baumannii (American Type Culture Collection (ATCC) 19606; ATCC, Manassas, VA, USA) and Escherichia coli (ATCC 25922; ATCC) were used in each run as the control. A. baumannii strains were identified by the use of a Vitek 2 system (BioMérieux Inc., Marcy-l′Étoile, France). The isolates were stored at −80°C. Mueller-Hinton broth II (MHB II; Difco Laboratories; BD Biosciences, San Jose, CA, USA) was used for all in vitro experiments. The strains were grown at 37°C with 5% CO2.

Determination of anti-microbial susceptibility

Antibiotic susceptibility was measured with the use of the standard disc diffusion process suggested by the Clinical and Laboratory Standards Institute (CLSI) guidelines by broth microdilution and E-test (cat. nos. 537300, 501800, 533500, 501300, 501600, 506710, 513800, 526000, 523600, 525508, 522000, 503500 and 521400; AB Biodisk; BioMérieux Inc.) (17). A total of 14 antibiotics were tested, including ampicillin-sulbactam, trimethoprim-sulfamethoxazole, aminoglycoside antibiotic amikacin, macrolide antibiotic azithromycin, β-lactam antibiotic aztreonam, β-lactamase inhibitor tazobactam, cephalosporin antibiotics ceftazidime and cephalothin, rifampin and tigecycline, carbapenem antibiotic meropenem and colistin, and the glycopeptide antibiotics teicoplanin and vancomycin (Bio-Rad, Laboratories, Inc., Hercules, CA, USA). These antibiotics are of different classes and have different killing mechanisms on the bacteria. The E-test technique was used to determine the minimum inhibitory concentrations (MICs) of meropenem. The results were interpreted according to the CLSI guidelines from 2015 (18).

Detection of antibiotic resistance genes

With reference to previous studies, a multiplex polymerase chain reaction (PCR)-reverse line blot assay was employed in the present study for detecting various clinically significant antibiotic resistance genes [NDM-1, VIM, IMP, SHV-5/12-like, VEB, KPC, OXA-10-like, CTX-M, TEM, OXA-23-like, OXA-30-like, DHA, CMY-2-like, armA, rmtC, aac(3)-IIc, aadB, aacC1, aac(6′)-Ib-cr, qnrA, qnrB and qnrS] (17,19). The primers are provided in Table I. PCR and genome walking were used to extend uncharacterized flanking regions of the NDM-1 gene (2023).

Table I.

Primers used for the amplification of selected carbapenemase genes.

Table I.

Primers used for the amplification of selected carbapenemase genes.

GenePrimer nameSequenceFragment size (bp)
NDM-1NDM-1 F 5′-ATGGAATTGCCCAATATTATGCACCCGG-3′813
NDM-1 R 5′-TCAGCGCAGCTTGTCGGCCATG-3′
VIM-1 and −2VIM F GATGGTGTTTGGTCGCATA390
VIM R CGAATGCGCAGCACCAG
IMPMultiIMP F 5′-TTGACACTCCATTTACDG-3′139
MultiIMP R 5′-GATYGAGAATTAAGCCACYCT-3′
SHV-5/12-likeSHV F 5′-GCCTTTATCGGCCCTCACTCAAG-3′897
SHV R 5′-TTAGCGTTGCCAGTGCTCGATCA-3′
VEBVEB F CATTTCCCGATGCAAAGCGT648
VEB R CGAAGTTTCTTTGGACTCTG
KPCKPC F 5′-TGTCACTGTATCGCCGTC-3′1010
KPC R 5′-CTCAGTGCTCTACAGAAAACC-3′
OXA-10-likeOXA-10 F 5′-CCACCAAGAAGGTGCCATGA-3′835
OXA-10 R 5′-GCGACCTTGAGCGACTTGTT-3′
CTX-MCTX-M Gp1 F 5′-TTAGGAARTGTGCCGCTGYA-3′688
CTX-M Gp1 R 5′-CGATATCGTTGGTGGTRCCAT-3′
TEMTEM F 5′-ATAAAATTCTTGAAGACGAAA-3′1079
TEM R 5′-GACAGTTAGCAATGCTTAATCA-3′
OXA-23-likeOXA-23 F 5′-GATGTGTCATAGTATTCGTCG-3′1067
OXA-23 R 5′-TCACAACAACTAAAAGCACTG-3′
OXA-30-likeOXA-30 F 5′-GGCACCAGATTCAACTTTCAAG-3′564
OXA-30 R 5′-GACCCCAAGTTTCCTGTAAGTG-3′
DHADHA F 5′-AACTTTCACAGGTGTGCTGGGT-3′405
DHA R 5′-CCGTACGCATACTGGCTTTGC-3′
CMY-2-likeCMY-2 F 5′-GCTGAGAGCTCATGATGAAAAAATCG-3′1146
CMY-2 R 5′-GGTACGGATCCTTATTGCAGC-3′
armAarmA F 5′-ATTCTGCCTATCCTAATTGG-3′315
armA R 5′-ACCTATACTTTATCGTCGTC-3′
rmtCrmtC F 5′-CGAAGAAGTAACAGCCAAAG-3′711
rmtC R 5′-ATCCCAACATCTCTCCCACT-3′
aac(3)-IIcaac(3)-IIc F 5′-ACGCGGAAGGCAATAACGGA-3′854
aac(3)-IIc R 5′-TAACCTGAAGGCTCGCAAGA-3′
aac(6′)-Ib-craac(6′)-Ib-cr F 5′-TTGCGATGCTCTATGAGTGGCTA-3′482
aac(6′)-Ib-cr R 5′-CTCGAATGCCTGGCGTGTTT-3′
aadB 5′-AACGCAGGTCACATTGATACA-3′266
5′-ACCAAGCAGGTTCGCAGTC-3′
aacC1aacC1 F 5′-CACCTACTCCCAACATCAGC-3′329
aacC1 R 5′-CTTCCCGTATGCCCAACT-3′
qnrAqnrA F 5′-ATTTCTCACGCCAGGATTTG-3′
qnrA R 5′-GATCGGCAAAGGTTAGGTCA-3′516
qnrBqnrB F 5′-ACGATGCCTGGTAGTTGTCC-3′469
qnrB R 5′-GATCGTGAAAGCCAGAAAGG-3′
qnrSqnrS F 5′-ACGACATTCGTCAACTGCAA-3′417
qnrS R 5′-TAAATTGGCACCCTGTAGGC-3′

[i] F, forward; R, reverse; NDM-1, New Delhi metallo-β-lactamase 1; bla, β-lactamase.

Molecular typing by multilocus sequence typing (MLST)

Strains were identified at the species level using the Vitek 2 system (BioMérieux) and then confirmed by 16S ribosomal DNA sequencing. Housekeeping genes (cpn60, gltA, gdhB, gpi, gyrB, recA and rpoD) were also detected by MLST and then sequenced (24). Tools obtained from the A. baumannii MLST database (http://pubmlst.org/abaumannii/) were employed to assign the isolates to sequence types (STs).

Phenotypic detection of NDM-1 production
Modified Hodge test

In the present study, the modified Hodge test for Enterobacteriaceae was performed according to the CLSI guidelines from 2015 (18). In brief, a 0.5 McFarland standard E. coli ATCC 25922 suspension was diluted at 1:10 and then spread onto Mueller-Hinton agar plates. Ertapenem (10 µg), imipenem (10 µg), and meropenem (10 µg) disks were placed. Subsequently, with the use of a sterile wire loop, 3–5 colonies of the isolated strain were inoculated in a straight line out from the rim on the same plate. K. pneumoniae ATCC 1705 was used as the Mueller-Hinton Test (MHT)-positive quality control (QC) organism and K. pneumoniae ATCC 1706 as the MHT-negative QC organism. The plates were then incubated for 16 to 20 h at a temperature of 37°C in ambient air (25). Those isolates with an intermediate or susceptible zone, i.e. 16–21 mm on disc diffusion, were considered to be positive for carbapenemase production.

Combined disk test (CDT) with EDTA

To detect NDM-1, the EDTA-CDT was performed using disks with meropenem (10 µg) and imipenem (10 µg), utilizing 750 µg EDTA (2628). The inhibition zone on the disk containing one antibiotic was compared with that on the disk with the combination of one antibiotic and EDTA. If the increase in the inhibition zone on the combined disk was >7 mm compared with that on the disc with imipenem alone, the strain was considered metallo-beta-lactamase-positive.

Checkerboard assay

The checkerboard tests aimed to validate the presence of synergism among anti-microbial agents at fixed concentrations. Checkerboard analysis was performed with colistin, vancomycin and β-lactamase inhibitors combined with meropenem. The checkerboard assay was used to determine antibiotic interactions, as previously described (29,30). The anti-microbials or β-lactamase inhibitors were applied in cation-adjusted Mueller-Hinton II broth (MHB II) at the following concentrations: Meropenem, 1–512 mg/l; ampicillin-sulbactam, 1/0.5–512/256 mg/l, tazobactam, 0.25–512 mg/l; and colistin, 0.124–32 mg/l. MHB II was filled into each well of 96-well, round-bottomed microtiter plates. The essential volume of drug solution at a concentration corresponding to the desired final concentration was then added to the wells. The final inoculum concentration of the A. baumannii was ~5×105 CFU/ml in a total volume of 200 µl. The plates were incubated at a temperature of 37°C for 48 h under aerobic conditions.

The turbidity of each well was assumed to represent microbiological growth. To define the interaction between anti-microbials, the fractional inhibitory concentration index (FICI) was employed, which was rated as follows: FICI≤0.5, synergism; 0.5<FICI≤4, indifference; FICI>4, antagonism (31).

Time-kill curve analysis

A. baumannii strain was diluted to ~5×105 CFU/ml with Mueller-Hinton broth. The drug concentrations of meropenem and colistin were adjusted to the 1×MIC or 0.5×MIC in the time-kill curve analysis. The Erlenmeyer flask was incubated at 37°C under aerobic conditions. The number of bacteria was determined at 0, 2, 4, 6, 8, 12, 24, 30, 36 and 48 h (32).

Statistical analysis

Values are expressed as the mean ± standard deviation. Statistical analysis was performed using GraphPad prism version 5.01 (GraphPad Inc., La Jolla, CA, USA). Two-way analysis of variance with Bonferroni's post-hoc tests was used to compare each group of antibiotics to the control group at the same time.

Results

In vitro susceptibility and genetic characterization of isolates

In the present study, five NDM-1-containing A. baumannii strains were identified among 264 isolates by PCR screening. Of these isolates, 3 were from blood specimens, one was from a cerebrospinal fluid sample and one was a urine isolate. All of the strains were resistant to the test antibiotics (Table II). By MLST, two strains were identified to be of ST357, while the remaining three strains were of ST191. Different genetic elements can influence the transmission of NDM-1 (Fig. 1). The ISAba125 element was present upstream of the NDM-1 gene in the five strains and may facilitate the rapid dissemination of the NDM-1 gene. As the NDM-1 A. baumannii strains were resistant to numerous antibiotics and carried a number of resistance genes, the characteristics of these strains were next studied.

Table II.

MIC values of NDM-1-producing and colistin-resistant A. baumannii strains.

Table II.

MIC values of NDM-1-producing and colistin-resistant A. baumannii strains.

MIC (µg/ml)

IsolateResistance genesMLSTSample typeTZPCSTSAM, ampicillin/sulbactamTGCAMKAZMATMCAZMEMRIFSXT, trimethoprim/sulfamethoxazoleVANTECCEP
1blaNDM-1, VIM-16, blaKPC, aadB, blaOXA-23ST191Blood8864/3282561286464128464/1216641281024
2blaNDM-1, blaCTX-M, aacC1ST191Blood128832/16812864646432432/121632128512
3blaNDM-1, blaCMY-2-like, aadB,ST357Cerebrospinal fluid324128/64432641283264864/60832256512
4blaNDM-1, blaOXA-23, blaCTX-M, aac(6′)-Ib-crST357Urine32864/321632323212832832/60864512256
5blaNDM-1, blaOXA-10, blaCMY-2-like, aac(6′)-Ib-crST191Cerebrospinal fluid16832/16321286432641284128/6081282561024

[i] MIC, minimum inhibitory concentration; CST, colistin; SAM, ampicillin-sulbactam; TGC, tigecycline; AMK, amikacin; AZM, azithromycin; ATM, aztreonam; CAZ, ceftazidime; MEM, meropenem; RIF, rifampin; SXT, trimethoprim-sulfamethoxazole; VAN, vancomycin; TEC, teicoplanin; CEP, cephalothin; TZP, tazobactam; NDM-1, New Delhi metallo-β-lactamase 1; ST, sequence type.

Phenotypic detection of NDM-1 production

The modified Hodge test was employed to detect carbapenemase production in the five isolates. The CDT in conjunction with EDTA revealed that the activity of NDM-1 was inhibited by EDTA.

Checkerboard assay

A synergistic interaction was identified for colistin-meropenem in four strains, for meropenem-ampicillin-sulbactam in two strains, for meropenem-vancomycin in two strains, as well as for meropenem-tazobactam in two strains (Table III). No antagonistic activity was detected for any of the combinations.

Table III.

Results of the checkerboard synergy test of A. baumannii harboring New Delhi metallo-β-lactamase 1.

Table III.

Results of the checkerboard synergy test of A. baumannii harboring New Delhi metallo-β-lactamase 1.

Meropenem + vancomycinMeropenem + ampicillin-sulbactamMeropenem + tazobactamMeropenem + colistin




IsolateFICIResultFICIResultFICIResultFICIResult
A. baumannii ATCC 196060.25Synergism0.5Synergism0.37Synergism0.26Synergism
10.310Synergism0.265Synergism1.25Indifference1.25Indifference
20.750Indifference0.532Indifference0.281Synergism0.281Synergism
30.562Indifference1.301Indifference0.375Synergism0.375Synergism
40.257Synergism1.057Indifference1.642Indifference0.281Synergism
50.255Indifference0.124Synergism2.000Indifference0.140Synergism

[i] FICI, fractional inhibitory concentration index; ATCC, American Type Culture Collection.

Activities of meropenem, colistin and their combination in a time-kill curve analysis

The second strain and the fourth strain harbored the NDM-1 and CTX-M genes. A synergistic interaction of colistin and meropenem was detected in these two strains, and the strains were therefore selected to study the inhibitory activities of the combination of colistin and meropenem in a time-kill curve analysis. When each strain was incubated with meropenem at a concentration of 0.5×MIC (16 mg/l), the bacterial growth was transiently inhibited but then regrew again (Fig. 2). Colistin at concentrations of 0.5×MIC (4 mg/l) and 1×MIC (8 mg/l) did not inhibit the growth of the two strains, although the concentration of 1×MIC (8 mg/l) had a transient inhibitory activity lasting for <6 h. The combination of meropenem and colistin at a concentration of 0.5×MIC had an inhibitory effect on the strains that lasted for longer than either antibiotic alone (up to 24 h). However, a sustained synergistic inhibitory activity lasting for >48 h was obtained with meropenem at a concentration of 0.5×MIC combined with colistin at a concentration of 1×MIC. After 48 h of cultivation, the bacterial quantity of the second strain was significantly affected in the presence of meropenem and colistin combined at a concentration of 0.5×MIC, as well as meropenem at 0.5×MIC combined with colistin at 1×MIC compared with that in the control group (P<0.001 for either; Fig. 2C). Furthermore, for the fourth strain, the number of cells was also significantly affected by the combination of meropenem and colistin at a concentration of 0.5×MIC and by the combination of meropenem at 0.5×MIC and colistin at 1×MIC (P<0.001 for either; Fig. 2D).

Discussion

A. baumannii, a significant nosocomial pathogen, particularly in intensive care units, is a major public health concern. Certain strains of this bacterium are resistant to a range of anti-microbial factors, including β-lactams, aminoglycosides, carbapenems and fluoroquinolones (33). The concern over this organism is mainly attributed to the rising MDR, encompassing colistin and carbapenems. NDM-1 is a β-lactamase belonging to an Ambler class B, and resistance to all β-lactams with the exception of aztreonam is conferred by this organism (34). NDM-1-positive Acinetobacter spp, with A. baumanii, A. pittii as well as A. lwoffii included, have been reported in China (35,36). Studies have also reported NDM-1 in A. baumannii isolated in certain other countries from 2010 onwards, and it was hypothesized that NDM-1 associated with the Tn125 transposon originates from the A. baumannii strain in a specific area of North Africa prior to the transfer to Enterobacteriaceae (37). Tn125 may be the major vehicle for the dissemination of NDM-1 genes in strains of A. baumannii. ISAba125 is present upstream of the NDM-1 gene and is also associated with the horizontal transfer of NDM-1 in A. baumannii (38). In the present study, ISAba125 was located upstream of NDM-1 in the five strains. The genes encoding the GroEL and GroES chaperonin proteins were identified downstream of NDM-1 in the five strains. These genes may be associated with the transfer of NDM-1.

Due to the emerging resistance and insufficient efficacy of the remaining monotherapy options, antibiotic combination therapy is increasingly used (39). However, clinical evidence for specific antibiotic combinations is lacking. Therefore, in vitro data derived from checkerboard or time-kill experiments are used to support the choice of treatment (40). Drug combinations have been used to defeat extensively MDR A. baumannii isolates, and the efficacy of combinations amongst the drugs has also been demonstrated in vitro (41). A previous study has demonstrated the synergy of imipenem and amikacin in a mouse model, but there was no improvement on imipenem monotherapy (42). Combinations of antimicrobial agents including rifampicin have been reported to have synergistic effects on MDR A. baumannii isolates. In a clinical study, imipenem + rifampicin combination therapy led to rifampicin resistance in the treatment of infections with carbapenem-resistant A. baumannii strains (43). In spite of good efficacy against infections of A. baumannii, colistin treatment has been abandoned due to its toxicity, whereas its use is now re-emerging (44). Despite the lack of sufficient evidence for the clinical benefit, the combination of colistin with rifampin has appeared to be one of the most commonly researched combinations in vitro (3). Another study demonstrated the effectiveness of sulbactam in the treatment of infections with carbapenem-resistant A. baumannii strains (45). The synergistic effect of sulbactam in conjunction with colistin on colistin-resistant A. baumannii strains has been reported (46). Normally, due to the relative impermeability of the outer membrane to such large hydrophobic molecules, vancomycin should exert no effect against Gram-negative organisms. However, colistin combined with vancomycin exhibited synergy (44). Meropenem combined with sulbactam exerted a more potent anti-microbial effect on certain A. baumannii strains than meropenem or sulbactam alone (32). In the present study, meropenem in combination with colistin, ampicillin-sulbactam, tazobactam and vancomycin exhibited synergistic effects against most strains harboring the NDM-1 gene in the checkerboard test. Meropenem with colistin was mostly effective against the MDR isolates of A. baumannii, which had a synergistic effect of 80% against A. baumannii, while other groups only had a synergistic effect of 40%. In the time-kill curve analysis, the combination of meropenem (0.5×MIC) and colistin (1×MIC) had a sustained synergistic bactericidal effect lasting for at least 48 h. Further clinical studies on the combination of the two drugs are required for delineating its clinical significance.

In conclusion, the present study indicated that meropenem plus colistin, ampicillin-sulbactam, tazobactam and vancomycin were effective against certain MDR strains of A. baumannii carrying the NDM-1 gene in vitro, and the combination therapy should be assessed in future in vivo pharmacological and toxicological studies.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

JHL conceived and designed the experiments and wrote the paper. JJW conceived, designed and performed the experiments. YZN, SL and YW performed the experiments. CMJ, HRY and YCH analyzed the data.

Ethical approval and consent to participate

The present study was approved by the Ethics Committee of Hongqi Hospital of Mudanjiang Medical College (Mudanjiang, China) and all participants provided informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Joly-Guillou ML: Clinical impact and pathogenicity of Acinetobacter. Clin Microbiol Infect. 11:868–873. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B and Spellberg B: Clinical and pathophysiological overview of acinetobacter infections: A century of challenges. Clin Microbiol Rev. 30:409–447. 2017.PubMed/NCBI

3 

Cai Y, Chai D, Wang R, Liang B and Bai N: Colistin resistance of Acinetobacter baumannii: Clinical reports, mechanisms and antimicrobial strategies. J Antimicrob Chemother. 67:1607–1615. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Novovic K, Mihajlovic S, Vasiljevic Z, Filipic B, Begovic J and Jovcic B: Carbapenem-resistant Acinetobacter baumannii from Serbia: Revision of CarO classification. PLoS One. 10:e01227932015. View Article : Google Scholar : PubMed/NCBI

5 

Boulanger A, Naas T, Fortineau N, Figueiredo S and Nordmann P: NDM-1-producing Acinetobacter baumannii from Algeria. Antimicrob Agents Chemother. 56:2214–2215. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Revathi G, Siu LK, Lu PL and Huang LY: First report of NDM-1-producing Acinetobacter baumannii in East Africa. Int J Infect Dis. 17:e1255–e1258. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Jones LS, Toleman MA, Weeks JL, Howe RA, Walsh TR and Kumarasamy KK: Plasmid carriage of bla NDM-1 in clinical Acinetobacter baumannii isolates from India. Antimicrob Agents Chemother. 58:4211–4213. 2014. View Article : Google Scholar : PubMed/NCBI

8 

El-Gamal MI, Brahim I, Hisham N, Aladdin R, Mohammed H and Bahaaeldin A: Recent updates of carbapenem antibiotics. Eur J Med Chem. 131:185–195. 2017. View Article : Google Scholar : PubMed/NCBI

9 

McGuinness WA, Malachowa N and DeLeo FR: Vancomycin resistance in Staphylococcus aureus. Yale J Biol Med. 90:269–281. 2017.PubMed/NCBI

10 

Acar JF, Goldstein FW and Kitzis MD: Susceptibility survey of piperacillin alone and in the presence of tazobactam. J Antimicrob Chemother. 31 (Suppl A):S23–S28. 1993. View Article : Google Scholar

11 

Sörgel F and Kinzig M: The chemistry, pharmacokinetics and tissue distribution of piperacillin/tazobactam. J Antimicrob Chemother. 31 (Suppl A):S39–S60. 1993. View Article : Google Scholar

12 

Joly-Guillou ML, Decré D, Herrman JL, Bourdelier E and Bergogne-Bérézin E: Bactericidal in-vitro activity of beta-lactams and beta-lactamase inhibitors, alone or associated, against clinical strains of Acinetobacter baumannii: Effect of combination with aminoglycosides. J Antimicrob Chemother. 36:619–629. 1995. View Article : Google Scholar : PubMed/NCBI

13 

Li J, Nation RL, Turnidge JD, Milne RW, Coulthard K, Rayner CR and Paterson DL: Colistin: The re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections. Lancet Infect Dis. 6:589–601. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Arroyo LA, Herrera CM, Fernandez L, Hankins JV, Trent MS and Hancock RE: The pmrCAB operon mediates polymyxin resistance in Acinetobacter baumannii ATCC 17978 and clinical isolates through phosphoethanolamine modification of lipid A. Antimicrob Agents Chemother. 55:3743–3751. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Moffatt JH, Harper M, Harrison P, Hale JD, Vinogradov E, Seemann T, Henry R, Crane B, St Michael F, Cox AD, et al: Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production. Antimicrob Agents Chemother. 54:4971–4977. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Kimberly CC, Anna DF and Michael JR: A review of novel combinations of colistin and lipopeptide or glycopeptide antibiotics for the treatment of multidrug-resistant Acinetobacter baumannii. Infect Dis Ther. 3:69–81. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Patel J, Cockerill F, Bradford P, Eliopoulos G, Hindler J, Jenkins S, Lewis J, Limbago B, Miller L, Nicolau D, et al: Performance standards for antimicrobial susceptibility testing: Twenty-fifth informational supplement; M100-S25Wayne, PA: CLSI; 35. 2015

18 

Clinical and Laboratory Standards Institute, . Performance standards for antimicrobial susceptibility testing; twenty-fifth informational supplement (M100-S25)Wayne (PA): The Institute; 2015

19 

Shoma S, Kamruzzaman M, Ginn AN, Iredell JR and Partridge SR: Characterization of multidrug-resistant Klebsiella pneumoniae from Australia carrying blaNDM-1. Diagn Microbiol Infect Dis. 78:93–97. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Rodriguez-Martinez JM, Nordmann P, Fortineau N and Poirel L: VIM-19, a metallo-beta-lactamase with increased carbapenemase activity from Escherichia coli and Klebsiella pneumoniae. Antimicrob Agents Chemother. 54:471–476. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Qin S, Fu Y, Zhang Q, Qi H, Wen JG, Xu H, Xu L, Zeng L, Tian H, Rong L, et al: High incidence and endemic spread of NDM-1-positive Enterobacteriaceae in Henan Province, China. Antimicrob Agents Chemother. 58:4275–4282. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Guo H and Xiong J: A specific and versatile genome walking technique. Gene. 381:18–23. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Li P, Yang C, Xie J, Liu N, Wang H, Zhang L, Wang X, Wang Y, Qiu S and Song H: Acinetobacter calcoaceticus from a fatal case of pneumonia harboring bla(NDM-1) on a widely distributed plasmid. BMC Infect Dis. 15:1312015. View Article : Google Scholar : PubMed/NCBI

24 

Pfeifer Y, Wilharm G, Zander E, Wichelhaus TA, Göttig S, Hunfeld KP, Seifert H, Witte W and Higgins PG: Molecular characterization of blaNDM-1 in an Acinetobacter baumannii strain isolated in Germany in 2007. J Antimicrob Chemother. 66:1998–2001. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Bartual SG, Seifert H, Hippler C, Luzon MA, Wisplinghoff H and Rodriguez-Valera F: Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J Clin Microbiol. 43:4382–4390. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Memish ZA, Assiri A, Almasri M, Roshdy H, Hathout H, Kaase M, Gatermann SG and Yezli S: Molecular characterization of carbapenemase production among gram-negative bacteria in saudi arabia. Microb Drug Resist. 21:307–314. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Poirel L, Héritier C, Tolün V and Nordmann P: Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother. 48:15–22. 2004. View Article : Google Scholar : PubMed/NCBI

28 

Chatterjee S, Datta S, Roy S, Ramanan L, Saha A, Viswanathan R, Som T and Basu S: Carbapenem resistance in Acinetobacter baumannii and other acinetobacter spp. causing neonatal sepsis: Focus on NDM-1 and its linkage to ISAba125. Front Microbiol. 7:11262016. View Article : Google Scholar : PubMed/NCBI

29 

Aaron SD, Ferris W, Henry DA, Speert DP and Macdonald NE: Multiple combination bactericidal antibiotic testing for patients with cystic fibrosis infected with Burkholderia cepacia. Am J Respir Crit Care Med. 161:1206–1212. 2000. View Article : Google Scholar : PubMed/NCBI

30 

Aaron SD, Ferris W, Ramotar K, Vandemheen K, Chan F and Saginur R: Single and combination antibiotic susceptibilities of planktonic, adherent, and biofilm-grown Pseudomonas aeruginosa isolates cultured from sputa of adults with cystic fibrosis. J Clin Microbiol. 40:4172–4179. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Percin D, Akyol S and Kalin G: In vitro synergism of combinations of colistin with selected antibiotics against colistin-resistant Acinetobacter baumannii. GMS Hyg Infect Control. 9:Doc142014.PubMed/NCBI

32 

Ko WC, Lee HC, Chiang SR, Yan JJ, Wu JJ, Lu CL and Chuang YC: In vitro and in vivo activity of meropenem and sulbactam against a multidrug-resistant Acinetobacter baumannii strain. J Antimicrob Chemother. 53:393–395. 2004. View Article : Google Scholar : PubMed/NCBI

33 

Abbo A, Navon-Venezia S, Hammer-Muntz O, Krichali T, Siegman-Igra Y and Carmeli Y: Multidrug-resistant Acinetobacter baumannii. Emerg Infect Dis. 11:22–29. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Nordmann P, Poirel L, Toleman MA and Walsh TR: Does broad-spectrum beta-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? J Antimicrob Chemother. 66:689–692. 2011. View Article : Google Scholar : PubMed/NCBI

35 

Chen Y, Zhou Z, Jiang Y and Yu Y: Emergence of NDM-1-producing Acinetobacter baumannii in China. J Antimicrob Chemother. 66:1255–1259. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Zhou Z, Guan R, Yang Y, Chen L, Fu J, Deng Q, Xie Y, Huang Y, Wang J, Wang D, et al: Identification of New Delhi metallo-β-lactamase gene (NDM-1) from a clinical isolate of Acinetobacter junii in China. Can J Microbiol. 58:112–115. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Tran DN, Tran HH, Matsui M, Suzuki M, Suzuki S, Shibayama K, Pham TD, Van Phuong TT, Dang DA, Trinh HS, et al: Emergence of New Delhi metallo-beta-lactamase 1 and other carbapenemase-producing Acinetobacter calcoaceticus-baumannii complex among patients in hospitals in Ha Noi, Viet Nam. Eur J Clin Microbiol Infect Dis. 36:219–225. 2017. View Article : Google Scholar : PubMed/NCBI

38 

Poirel L, Bonnin RA, Boulanger A, Schrenzel J, Kaase M and Nordmann P: Tn125-related acquisition of blaNDM-like genes in Acinetobacter baumannii. Antimicrob Agents Chemother. 56:1087–1089. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Karaiskos I and Giamarellou H: Multidrug-resistant and extensively drug-resistant Gram-negative pathogens: Current and emerging therapeutic approaches. Expert Opin Pharmacother. 15:1351–1370. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Tamma PD, Cosgrove SE and Maragakis LL: Combination therapy for treatment of infections with gram-negative bacteria. Clin Microbiol Rev. 25:450–470. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Marques MB, Brookings ES, Moser SA, Sonke PB and Waites KB: Comparative in vitro antimicrobial susceptibilities of nosocomial isolates of Acinetobacter baumannii and synergistic activities of nine antimicrobial combinations. Antimicrob Agents Chemother. 41:881–885. 1997. View Article : Google Scholar : PubMed/NCBI

42 

Rodríguez-Hernández MJ, Pachón J, Pichardo C, Cuberos L, Ibáñez-Martínez J, García-Curiel A, Caballero FJ, Moreno I and Jiménez-Mejías ME: Imipenem, doxycycline and amikacin in monotherapy and in combination in Acinetobacter baumannii experimental pneumonia. J Antimicrob Chemother. 45:493–501. 2000. View Article : Google Scholar : PubMed/NCBI

43 

Wolff M, Joly-Guillou ML, Farinotti R and Carbon C: In vivo efficacies of combinations of beta-lactams, beta-lactamase inhibitors, and rifampin against Acinetobacter baumannii in a mouse pneumonia model. Antimicrob Agents Chemother. 44:1406–1411. 1999. View Article : Google Scholar

44 

Gordon NC, Png K and Wareham DW: Potent synergy and sustained bactericidal activity of a vancomycin-colistin combination versus multidrug-resistant strains of Acinetobacter baumannii. Antimicrob Agents Chemother. 54:5316–5322. 2010. View Article : Google Scholar : PubMed/NCBI

45 

Levin AS: Multiresistant Acinetobacter infections: A role for sulbactam combinations in overcoming an emerging worldwide problem. Clin Microbiol Infect. 8:144–153. 2002. View Article : Google Scholar : PubMed/NCBI

46 

Kempf M, Djouhri-Bouktab L, Brunel JM, Raoult D and Rolain JM: Synergistic activity of sulbactam combined with colistin against colistin-resistant Acinetobacter baumannii. Int J Antimicrob Agents. 39:180–181. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October 2019
Volume 18 Issue 4

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
APA
Wang, J., Ning, Y., Li, S., Wang, Y., Liang, J., Jin, C. ... Huang, Y. (2019). Multidrug‑resistant Acinetobacter baumannii strains with NDM‑1: Molecular characterization and in vitro efficacy of meropenem‑based combinations. Experimental and Therapeutic Medicine, 18, 2924-2932. https://doi.org/10.3892/etm.2019.7927
MLA
Wang, J., Ning, Y., Li, S., Wang, Y., Liang, J., Jin, C., Yan, H., Huang, Y."Multidrug‑resistant Acinetobacter baumannii strains with NDM‑1: Molecular characterization and in vitro efficacy of meropenem‑based combinations". Experimental and Therapeutic Medicine 18.4 (2019): 2924-2932.
Chicago
Wang, J., Ning, Y., Li, S., Wang, Y., Liang, J., Jin, C., Yan, H., Huang, Y."Multidrug‑resistant Acinetobacter baumannii strains with NDM‑1: Molecular characterization and in vitro efficacy of meropenem‑based combinations". Experimental and Therapeutic Medicine 18, no. 4 (2019): 2924-2932. https://doi.org/10.3892/etm.2019.7927