Open Access

Gene expression alterations of human liver cancer cells following borax exposure

  • Authors:
    • Lun Wu
    • Ying Wei
    • Wen‑Bo Zhou
    • You‑Shun Zhang
    • Qin‑Hua Chen
    • Ming‑Xing Liu
    • Zheng‑Peng Zhu
    • Jiao Zhou
    • Li‑Hua Yang
    • Hong‑Mei Wang
    • Guang‑Min Wei
    • Sheng Wang
    • Zhi‑Gang Tang
  • View Affiliations

  • Published online on: May 23, 2019     https://doi.org/10.3892/or.2019.7169
  • Pages: 115-130
  • Copyright: © Wu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Borax is a boron compound that is becoming widely recognized for its biological effects, including lipid peroxidation, cytotoxicity, genotoxicity, antioxidant activity and potential therapeutic benefits. However, it remains unknown whether exposure of human liver cancer (HepG2) cells to borax affects the gene expression of these cells. HepG2 cells were treated with 4 mM borax for either 2 or 24 h. Gene expression analysis was performed using Affymetrix GeneChip Human Gene 2.0 ST Arrays, which was followed by gene ontology analysis and pathway analysis. The clustering result was validated using reverse transcription‑quantitative polymerase chain reaction. A cell proliferation assay was performed using Celigo Image Cytometer Instrumentation. Following this, 2‑ or 24‑h exposure to borax significantly altered the expression level of a number of genes in HepG2 cells, specifically 530 genes (384 upregulated and 146 downregulated) or 1,763 genes (1,044 upregulated and 719 downregulated) compared with the control group, respectively (≥2‑fold; P<0.05). Twenty downregulated genes were abundantly expressed in HepG2 cells under normal conditions. Furthermore, the growth of HepG2 cells was inhibited through the downregulation of PRUNE1, NBPF1, PPcaspase‑1, UPF2 and MBTPS1 (≥1.5‑fold, P<0.05). The dysregulated genes potentially serve important roles in various biological processes, including the inflammation response, stress response, cellular growth, proliferation, apoptosis and tumorigenesis/oncolysis.

Introduction

Boron is a naturally occurring element, representing 0.001% of the Earth's crust (1). Borax, which is also known as sodium tetraborate decahydrate (Na2B4O710H2O), is an important boron compound (2). In animals and humans, borax has been reported to be involved in metabolic processes associated with hormones and minerals (3). It has also been demonstrated to possess anti-inflammatory activity, indicating its therapeutic potential (4,5). Boron supplementation in the diet (borax, 100 mg/kg) has also been implicated to decrease lipid peroxidation and enhance antioxidant defense (6). Previous studies have suggested that the mechanism underlying the anti-inflammatory properties of borax involved the suppression of interleukin (caspase-)-8, indicating that borax is potentially applicable for a bactericidal agent (7,8). However, numerous studies exploring the mutagenic properties of borax reported that its genotoxicity was nearly undetectable in bacteria and cultured mammalian cells (9,10). Furthermore, previous studies revealed that different concentrations of borax affected cell survival and cell growth in addition to altering the properties of a few chromosomes in humans, which were possibly caused by various genetic defects resulting from abnormalities in human chromosome (11,12). Additionally, borax has been widely known to have detrimental effects on lymphocyte proliferation, which is also highly vulnerable to induced sister chromatid exchange in human chromosomes (13). Thus, certain cellular toxicities indicated that those alterations were ascribed to genetic defects caused by borax in humans (14). Notably, it has been recently identified that borax treatment enhanced the resistance of DNA to titanium dioxide-induced damage (15). Taken together, numerous studies have focused on the application of borax for tumor prevention and demonstrated a strong inverse correlation between borax and various types of cancer, including prostate cancer, lung cancer, cervical cancer and hepatocellular carcinoma (HCC) (615). Although increasing studies have revealed various functions for borax, the underlying mechanisms of those effects remain unidentified, in particular regarding its genetic influences on various cells.

Our previous results indicated the effects of borax on tumor cells (HepG2) in vitro (Wu et al unpublished data). It was revealed that caspase--6 expression was increased following 2-h borax treatment in HepG2 cells and cell proliferation was inhibited following 24-h borax (4 mM) treatment. The numbers of living HepG2 cells and the borax concentrations were inversely correlated. Additionally, the 50% inhibitory concentration of borax was estimated as 4 mM (16). Although borax can be genotoxic at high doses, it is not highly mutagenic and does not easily form DNA adducts (17). Accordingly, borax is considered to induce oxidative stress through the depletion of glutathione and protein-bound sulfhydryl groups, which results in enhanced apoptosis and the production of reactive oxygen species (18,19). In brief, borax is predominately non-genotoxic and epigenetic mechanisms are likely to underlie the mechanism for its induction of carcinogenesis, during which the expression of multiple essential genes are altered (12).

Theoretically, exposure of HepG2 cells to borax for either 2 or 24 h may induce alterations in the expression levels in various critical genes, and these genes may therefore serve essential roles in various signaling pathways. The present study explored gene expression alterations directly caused by treatments with doses of borax (4 mM) in HepG2 cells for either 2 or 24 h and investigated the biological functions of those genes with significantly altered expression levels. Analysis of gene expression was performed through assessment of Affymetrix GeneChip data, followed by gene ontology (GO) analysis and pathway analysis.

Materials and methods

Cell culture

HepG2 cells were obtained from the China Center for Type Culture Collection (Wuhan University, Wuhan, China) and seeded in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS; cat. no. 10099-141; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) 1 day prior to borax (4 mM; Tianjin Bodi Chemical Co. Ltd., Tianjin, China) treatment in a humidified 5% CO2 incubator at 37°C for either 2 or 24 h. Following 2- or 24-h treatment with 4 mM borax, the culture medium was replenished with fresh media without borax.

RNA extraction and microarray hybridization

Following borax treatment, total RNA was extracted from HepG2 cells using TRIzol (cat. no. 3101-100; Invitrogen; Thermo Fisher Scientific, Inc.), followed by its purification using a miRNeasy Mini Kit (cat. no. 217004; Qiagen GmbH, Hilden, Germany). RNA integrity was also examined using an Agilent Bioanalyzer 2100 (grant no. G2938A; Agilent Technologies, Inc., Santa Clara, CA, USA). To obtain biotin-tagged cDNA, total RNA was subsequently amplified, labeled and purified using a WT PLUS Reagent kit (cat. no. 902280; Affymetrix; Thermo Fisher Scientific, Inc.). Array hybridization was performed using an Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix; Thermo Fisher Scientific, Inc.) and Hybridization Oven 645 (cat. no. 00-0331-220V; Affymetrix; Thermo Fisher Scientific, Inc.), the Gene Chip was subsequently washed using a Hybridization, Wash and Stain Kit (cat. no. 900720; Affymetrix; Thermo Fisher Scientific, Inc.) in a Fluidics Station 450 (cat. no. 00-0079, Affymetrix; Thermo Fisher Scientific, Inc.). A GeneChip Scanner 3000 (cat. no. 00-00213; Affymetrix; Thermo Fisher Scientific, Inc.) was used to scan the results, which were controlled by Command Console Software 4.0 (Affymetrix; Thermo Fisher Scientific, Inc.) to summarize probe cell intensity data, namely, the CEL files with default settings. Following this, CEL files were normalized according to gene and exon level using Expression Console Software 4.0 (Affymetrix; Thermo Fisher Scientific, Inc.). All of the procedures, including array hybridization and scanning, were independently performed according to a standard protocol (20) for microarray experiments (n=3).

Validation of selected differentially expressed genes using reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Single-stranded cDNAs were converted from 2.0 µg of total RNA extracted from cells using an RT kit (cat. no. M1701; Promega Corporation, Madison, WI, USA) with a temperature protocol of 72°C for 10 min. qPCR analysis was performed using 2.0 µg cDNA from each sample, pair-specific primers (Table I; Shanghai GeneChem Co., Ltd., Shanghai, China) and a SYBR green PCR Master Mix kit (cat. no. 639676; Takara Bio, Inc., Otsu, Japan). The thermocycling conditions used were as follows: 40 cycles at 95°C for 30 sec, 72°C for 45 sec, and 1 cycle at 72°C for 10 min. Quantitative measurement of the expression level of each gene was obtained by independent experiments (n=3). Samples were normalized to the expression level of GAPDH. Additionally, according to the 2−ΔΔCq method (21), all of the results were detected as fold-change relative to the corresponding mRNA expression level in control cells.

Table I.

Sequences of primers employed for reverse transcription-quantitative polymerase chain reaction and their anticipated polymerase chain reaction product size.

Table I.

Sequences of primers employed for reverse transcription-quantitative polymerase chain reaction and their anticipated polymerase chain reaction product size.

PrimerForward (5′-3′)Reverse (5′-3′)Length (bp)
AZI2 AACACTAAGGAATCGAAACTCG GAGCAAAATGGGAAGCAACAG186
BPGM GCGTCTAAATGAGCGTCACTAT GGAGGCGGGGTTACATTGTAG120
FAM102B TGCTGGTGAATCTGAATCTTTG CTGAGGTATTTCTCCTGTGGC236
FBXO9 AGTGGATGTTTGAACTTGCTC GCCTGTTCTTGTTTTCCTTTG121
HOXB5 GACCACGATCCACAAATCAAGC TGCCACTGCCATAATTTAGCAAC120
KIAA0430 ACCCTCCACTTCGCCAATG CTTTGCGAGTCTAACAGTGCG96
MBTPS1 TTTGACACTGGGCTGAGCGAGAA CGCCGATGCTGAGGTTTAACACG280
MYO10 AGGAGGAAGTTCGGGAAGTGT CTTCTCCCCTGAGGAACATTG192
NBPF1 GCCCTGATGTAGAAACTTC ATTCTTAGCAGTACGATTCG146
PRUNE1 GCCTCAAGTACCCACCCTAAC AGAGGGCACTCATCCACCAAG278
SETD5 TACCTGGTGTCCTTGTGGTCT CGCTTCTTGGGTTTGGTTCTT246
SNX13 ATATCCTCTGCTTTGTGGGTG AGATTCATCATCGCTTAGTGT281
TSR2 CCCTGTTCCTCTGTCTGGCTCC CTTCCTCACAATGACCGCACC169
TTLL4 TCTTTCTGCTTGCGTTCGAG AGAGGTATGGTTCTGTGGATGAG154
UPF2 GGAGGTATCAAGTCCCGATGA GTTGGGTAACTGCTGTAGGAAAG202
RCN2 TTCAGGTCCCGGTTTGAGTCT TCAAGCCTGCCATCGTTATCT252
USP16 ATGAGGTCCAGTATTGTAGTTC ACTGAGTCCTTTCACGGTTAT236
RASL11A TATTCACGGCTGGTCTATGTCG CACGCATTTGGACAGGGAATC120
PPIL1 TGGGAATCATTGTGCTGGAG CGAGGGTCACAAAGAACTGG291
MTIF2 TGGTTGCTGGAAAATGTTGGG CACGGGCTTTCTGATGTGCTT276
MAPK4 CGGTGTCAATGGTTTGGTGC GACGATGTTGTCGTGGTCCA151
LMAN2L ACTCGCTGTCGAAGCCCTA CTGGGGTAAGGCGGATATACT105
CENPN TGAACTGACAACAATCCTGAAG CTTGCACGCTTTTCCTCACAC129
CDCA8 GCAGGAGAGCGGATTTACAAC CTGGGCAATACTGTGCCTCTG141
EFR3A GCTGTTCCGCTTTGCGTCCTC AGAAGTTGGTCCAGTGCCTCC232
PPIP5K2 ACTGGACAAAGCGGTTGCCTAT TGGGATTATTTGGGTCACGGT167
Construction of adenoviral vectors

PCR was performed to amplify the encoding sequences of abundantly expressed genes. Gene interference RNA fragments (100 µmol; three codon sites; Table II) of those amplified sequences were subcloned into a plasmid (300 ng/µl; Shanghai GeneChem Co., Ltd., Shanghai, China) backbone using the T4DNA ligase (cat. no. 170702; Takara Bio, Inc.) following the digestion of the restriction enzyme. The pGCScaspase--004-iRNA and the GV115-NC were co-transformed into Escherichia coli GRM602 with backbone vector GV115-NC for homologous recombination. The recombinant plasmid pAd-iRNA digested with PacI (Fermentas; Thermo Fisher Scientific, Inc.) was used to transfect 293T cells (Thermo Fisher Scientific, Inc.) using Lipofectamine 2000 (cat. no. 11668-027; Invitrogen; Thermo Fisher Scientific, Inc.) for further packaging and amplification of the viruses and used in all groups (including any controls). The time interval was 72 h between transfection and subsequent experimentation. A control group (non-targeting shRNA) and positive control (specific-targeting shRNA) were used.

Table II.

Sequences of RNAis (three codon sites for each gene) employed to plasmid backbone.

Table II.

Sequences of RNAis (three codon sites for each gene) employed to plasmid backbone.

GenesCodon sitesTarget sequence
PRUNE1PSC56272 TCGAGAAGTGCAGTCAGAT
PSC56273 ATGTAAGTTGCCAACAGTT
PSC56274 GCATGGATCTTGAACAGAA
NBPF1PSC29636 GCGAGAAGGCAGAGACGAA
PSC29637 TGACAATGATCACGATGAA
PSC29638 AGTCATATTCCCACAGTAA
PPIL1PSC40511 ACAGAATTATCAAAGACTT
PSC40512 AGGTTACTACAATGGCACA
PSC40513 CTCCAAAGACCTGTAAGAA
UPF2PSC56248 GCCTAGATTCGAGCTTAAA
PSC56249 CACCTAATGCAGATCTAAT
PSC56250 CTTGTACCAAGGAAAGTAA
MBTPS1PSC56266 GTCGTGATAACACAGACTT
PSC56267 TAACAATGTAATCATGGTT
PSC56268 TGACTTTGAAGGTGGAATT
SETD5PSC56263 ACTTTGTAAGTCAGATGAT
PSC56264 GCATTTAGATCATCACAAA
PSC56265 ATCAGGAACACTGACCATT
RCN2PSC42354 GCTTCATCTAATTGATGAA
PSC42355 GGTTTGAGTCTTGAAGAAT
PSC42356 GATGTATGATCGTGTGATT
TSR2PSC48385 CCAGTTTGTTAAACTCCTT
PSC48386 CTTTACTCAGGATTTACTA
PSC48387 AAAGAATGTGCGGTCTTTA
SNX13PSC56275 CAATTCAATGAGGAATGTT
PSC56276 CTGAAATCTTTGATGACAT
PSC56277 TGATTCTAACTGCAACTAT
CENPNPSC32095 AACTGACAACAATCCTGAA
PSC32096 AATGCAGTCTGGATTCGAA
PSC32097 TAGTTCAGCACTTGATCCA
PPIP5K2PSC36126 CTGTGATGTGTTTCAGCAT
PSC36127 TGAAATTTCCACTAGCGAA
PSC36128 AGAGATTCATTGGAGACTA
USP16PSC56254 GTGATATTCCACAAGATTT
PSC56255 GAATAAACTGCTTTGTGAA
PSC56256 CAGAAGAAATCATGTTTAT
TTLL4PSC42339 TGGTCAGTTTGAACGAATT
PSC42340 ACATGAAGTCTCCTAGTTT
PSC42341 CCTCATCTACAGTCTCTTT
AZI2PSC56260 ATATCGAGAGGTTTGCATT
PSC56261 GAGGACAGAGGTGGAAACTCA
PSC56262 CAGCTACAATCTAAAGAAGTA
LMAN2LPSC41153 CATAGTCATTGGTATCATA
PSC41154 GGCATTTGACGATAATGAT
PSC41155 AACGTTCGAGTACTTGAAA
CDCA8PSC24168 TTGACTCAAGGGTCTTCAA
PSC24169 TGGATATCACCGAAATAAA
PSC24170 CCTCCTTTCTGAAAGACTT
BPGMPSC39388 AGCCATTAAGAAAGTAGAA
PSC39389 CATTCTTCTGGAATTGGAT
PSC39390 CGAAGTATTACGTGGCAAA
MTIF2PSC56269 AGACTCACATTTAGATGAA
PSC56270 CGTAATGGACATGTAATTT
PSC56271 AGGAGAAGAAATTCTTGAA
MAPK4PSC56251 AAGGATCGTGGATCAACAT
PSC56252 GACCTCAATGGTGCGTGCA
PSC56253 TCGCGCAGTGGGTCAAGAG
FBXO9PSC56257 AGAGGTTCAACAAACTCAT
PSC56258 TCAGATCATTGGAGCAGTT
PSC56259 TGATATAGAGTTCAAGATT
Cell culture and transfection

HepG2 cells were seeded in a 96-well black-bottom plate (1,500-2,500 cells/well; Corning Inc., Corning, NY, USA) filled with DMEM supplemented with FBS in a humidified incubator containing 5% CO2 at 37°C. The viral particles were added to serum-free medium when confluency reached 20–40 %. The media was replaced with fresh medium supplemented with FBS following 12 h of incubation. Cells were subsequently incubated for a further 72 h until the transfection rate reached 70–90 %. GFP expression was analyzed in HepG2 cells 48 and 72 h post-infection with AdGFP using fluorescence and light microscopy to determine the optimal transfection rate for subsequent experiments. Cells were subsequently collected for further use. Decreased expression of genes following treatment with shRNA was validated with RT-qPCR.

Cell proliferation assay

To identify the specific effects of those abundantly expressed genes on the proliferation of HepG2 cells, these cells were infected with adenovirus, seeded in a 96-well plate (2×103/well) and cultured in a humidified incubator containing 5% CO2 at 37°C for 24 h. The plates were scanned using Celigo Image Cytometer Instrumentation (Nexcelom Bioscience Instruments (Shanghai) Co., Ltd.m Shanghai, China) (22,23) to acquire images every 24 h, measuring the number of viable cells with 5-day sequential monitoring. Gross quantitative analyses were independently performed (n≥3), including the total number count, cell growth [shControl/experimental (transfected with RNAiMax) group, >1.5-fold change], position information and average integrated intensity of certain gated events for each fluorescence channel in individual wells.

Statistical analysis

A computational analysis of microarray data was performed using GeneSpring v12.0 (Agilent Technologies, Inc., Santa Clara, CA, USA). Based on a Student's t-test analysis, differentially expressed genes were filtered through statistical estimation of fold-changes from replicated samples (fold change ≥2.0) using a P-value threshold (P<0.05). Distinguishable gene expression of those samples was demonstrated via hierarchical clustering, followed by heatmap generation. Additionally, GO and pathway analyses of differentially expressed genes were performed to determine the potential signaling pathways underlying their biological functions. Public data from bioinformatics resources (http://www.geneontology.org/) were utilized for GO enrichment analysis. Ingenuity Pathway Analysis was utilized to identify genes whose expression was changed by at least 2-fold.

Results

Gene expression changes

Gene microarray analysis revealed that there were significant expressional alterations of 530 genes in HepG2 cells in the 2-h borax treatment group compared with the control group (fold change ≥2.0; P<0.05). Among them, 146 genes were downregulated and 384 genes were upregulated (P<0.05; Fig. 1A). Furthermore, the expression levels of 1,763 genes were changed in HepG2 cells when the 24-h borax treatment group was compared with the control group (fold change ≥2.0; P<0.05). Among these genes, 719 were downregulated and 1,044 were upregulated (P<0.05; Fig. 1B).

Gene expression and GO analysis

Differentially expressed genes were stratified by treatment duration and presented as heatmaps either in red (upregulation) or green (downregulation), revealing an overall global change in expression for all genes (P<0.05; Fig. 2). Furthermore, detectable differences in gene expression patterns among those groups were also revealed by hierarchical clustering analyses. To determine the biological dysfunctionality associated with the altered gene expression induced by borax treatment, public data from bioinformatics resources (http://www.geneontology.org/) were utilized for GO enrichment analysis. Based on the cellular components, biological processes and molecular functions of each gene, significantly enriched GO terms were also arranged correspondingly (Fig. 3).

Pathway analysis

To determine which pathways were involved, Ingenuity Pathway Analysis was utilized to identify genes whose expression was changed by at least 2-fold. Furthermore, analyses of functional pathways indicated that the genes with expression levels that were significantly altered in cells from the 2-h treatment group compared with those in the control group were involved in seven KEGG pathways (P<0.01; Table III). Furthermore, significantly altered genes in cells from the 24-h treatment group compared with those in the control group were primarily associated with five KEGG pathways (P<0.01; Table IV).

Table III.

Differentially expressed genes involved in signal transduction (2 h vs. Control group).

Table III.

Differentially expressed genes involved in signal transduction (2 h vs. Control group).

Pathway/genebank IDProbe_Set_IDGene symbolDescription of expression productFold changeP-valuesRegulation after borax treeatment
hsa04010:MAPK signaling pathway

NM_001202233 TC12000414.hg.1NR4A1Nuclear receptor subfamily 4, group A, member 121.70.000881Up
NM_005252 TC11001948.hg.1FOSFBJ murine osteosarcoma viral oncogene homolog11.30.000164Up
NM_001199741 TC01000745.hg.1GADD45AGrowth arrest and DNA-damage-inducible, alpha10.70.000054Up
NM_004419 TC10000801.hg.1DUSP5Dual specificity phosphatase 510.60.000096Up
NM_000575 TC02002218.hg.1IL1AInterleukin-1, alpha8.30.005040Up
NM_001394 TC08001099.hg.1DUSP4Dual specificity phosphatase 45.60.002509Up
NM_005354 TC19001285.hg.1JUNDJun D proto-oncogene3.40.001100Up
NM_015675 TC19000055.hg.1GADD45BGrowth arrest and DNA-damage-inducible, beta3.30.000382Up
NM_001195053 TC12001625.hg.1DDIT3 DNA-damage-inducible transcript 32.30.005761Up
NM_030640 TC12001255.hg.1DUSP16Dual specificity phosphatase 162.30.000079Up
NM_000576 TC02002219.hg.1IL1BInterleukin-1, beta2.10.016505Up
NM_004651 TC05001184.hg.1MYO10Myosin 10−7.170.001269Down
NM_005345 TC06000384.hg.1HSPA1AHeat shock 70 kDa protein 1A−4.20.011012Down
NM_005346 TC06000385.hg.1HSPA1BHeat shock 70 kDa protein 1B−4.30.010610Down
NM_002228 TC01001927.hg.1JUNJun proto-oncogene−2.10.000287Down

hsa04064:NF-kappa B signaling pathway

NM_000963 TC01003638.hg.1PTGS2 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)75.70.000000Up
NM_006290 TC06001027.hg.1TNFAIP3Tumor necrosis factor, alpha-induced protein 368.30.000000Up
NM_020529 TC14001036.hg.1NFKBIANuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha9.20.000014Up
NM_001165 TC11000956.hg.1BIRC3Baculoviral IAP repeat containing 33.70.000004Up
NM_002089 TC04001286.hg.1CXCL2Chemokine (C-X-C motif) ligand 24.00.010873Up
NM_015675 TC19000055.hg.1GADD45BGrowth arrest and DNA-damage-inducible, beta3.30.000382Up
NM_000576 TC02002219.hg.1IL1BInterleukin-1, beta2.10.016505Up

hsa04621:NOD-like receptor signaling pathway

NM_006290 TC06001027.hg.1TNFAIP3Tumor necrosis factor, alpha-induced protein 368.30.000000Up
NM_020529 TC14001036.hg.1NFKBIANuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha9.20.000014Up
NM_002089 TC04001286.hg.1CXCL2Chemokine (C-X-C motif) ligand 24.00.010873Up
NM_001165 TC11000956.hg.1BIRC3Baculoviral IAP repeat containing 33.70.000004Up
NM_000576 TC02002219.hg.1IL1BInterleukin-1, beta2.10.016505Up
NM_000600 TC05002383.hg.1IL6Interleukin-62.40.007231Up
NM_100616406 TC17000132.hg.1MIR4521MicroRNA 4521−6.610.000125Down

hsa04115:p53 signaling pathway

NM_001199741 TC01000745.hg.1GADD45AGrowth arrest and DNA-damage-inducible, alpha10.70.000054Up
NM_003246 TC15000270.hg.1THBS1Thrombospondin 16.50.002300Up
NM_000602 TC07000643.hg.1SERPINE1Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 14.70.010348Up
NM_021127 TC18000213.hg.1PMAIP1 Phorbol-12-myristate-13-acetate-induced protein 14.70.000034Up
NM_015675 TC19000055.hg.1GADD45BGrowth arrest and DNA-damage-inducible, beta3.30.000382Up

hsa04141:Protein processing in endoplasmic reticulum

NM_014330 TC19000711.hg.1PPP1R15AProtein phosphatase 1, regulatory subunit 15A4.40.006746Up
NM_018566 TC01003773.hg.1YOD1YOD1 OTU deubiquinating enzyme 1 homolog3.70.000181Up
NM_001433 TC17001796.hg.1ERN1Endoplasmic reticulum to nucleus signaling 12.60.000008Up
NM_001195053 TC12001625.hg.1DDIT3 DNA-damage-inducible transcript 32.30.005761Up
NM_005346 TC06000385.hg.1HSPA1BHeat shock 70 kDa protein 1B−4.30.010610Down
NM_005345 TC06000384.hg.1HSPA1AHeat shock 70 kDa protein 1A−4.20.011012Down
NM_003791 TC16001307.hg.1MBTPS1Membrane-bound transcription factor peptidase, site 1−3.20.000643Down
NM_001172415 TC09001009.hg.1BAG1BCL2-associated athanogene−2.10.000440Down

hsa04668:TNF signaling pathway

NM_000963 TC01003638.hg.1PTGS2 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)75.70.000000Up
NM_006290 TC06001027.hg.1TNFAIP3Tumor necrosis factor, alpha-induced protein 368.30.000000Up
NM_001168319 TC06000087.hg.1EDN1Endothelin 113.10.000004Up
NM_005252 TC11001948.hg.1FOSFBJ murine osteosarcoma viral oncogene homolog11.30.000164Up
NM_020529 TC14001036.hg.1NFKBIANuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha9.20.000014Up
NM_002089 TC04001286.hg.1CXCL2Chemokine (C-X-C motif) ligand 24.00.010873Up
NM_001165 TC11000956.hg.1BIRC3Baculoviral IAP repeat containing 33.70.000004Up
NM_001130046 TC02001364.hg.1CCL20Chemokine (C-C motif) ligand 203.00.002008Up
NM_000600 TC05002383.hg.1IL6Interleukin-62.40.007231Up
NM_000576 TC02002219.hg.1IL1BInterleukin-1, beta2.10.016505Up
NM_003955 TC17001917.hg.1SOCS3Suppressor of cytokine signaling 32.10.003726Up
NM_002228 TC01001927.hg.1JUNJun proto-oncogene−2.10.000287Down

hsa04620:Toll-like receptor signaling pathway

NM_005252 TC11001948.hg.1FOSFBJ murine osteosarcoma viral oncogene homolog11.30.000164Up
NM_020529 TC14001036.hg.1NFKBIANuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha9.20.000014Up
NM_000600 TC05002383.hg.1IL6Interleukin-62.40.007231Up
NM_000576 TC02002219.hg.1IL1BInterleukin-1, beta (IL1B)2.10.016505Up
NM_002228 TC01001927.hg.1JUNJun proto-oncogene−2.10.000287Down

Table IV.

Differentially expressed genes involved in signal transduction (24 h vs. control group).

Table IV.

Differentially expressed genes involved in signal transduction (24 h vs. control group).

Pathway/Genebank IDProbe_Set_IDGene symbolDescription of expression productFold changeP-valuesRegulation after borax treeatment
hsa04110:Cell cycle

NM_002392 TC12000606.hg.1MDM2Mdm2, p53 E3 ubiquitin protein ligase homolog13.80.00010Up
NM_001199741 TC01000745.hg.1GADD45AGrowth arrest and DNA-damage-inducible, alpha7.90.00006Up
NM_000389 TC06000532.hg.1CDKN1ACyclin-dependent kinase inhibitor 1A (p21, Cip1)4.40.00015Up
NM_001259 TC07001603.hg.1CDK6Cyclin-dependent kinase 64.30.00013Up
NM_001079846 TC16000823.hg.1CREBBPCREB binding protein (CREBBP)3.00.00007Up
NM_001799 TC05000301.hg.1CDK7Cyclin-dependent kinase 72.80.00039Up
NM_007637 TC10001228.hg.1ZNF84Zinc finger protein 842.420.00063Up
NM_001789 TC03001374.hg.1CDC25ACell division cycle 25 homolog A2.40.00041Up
NM_002553 TC07001724.hg.1ORC5Origin recognition complex, subunit 52.30.00012Up
BC012827 TC01000545.hg.1CDC20Cell division cycle 20 homolog2.20.00364Up
NM126792 TC05001184.hg.1B3GALT6Beta 1,3-galactosyltransferase polypeptide 6−18.970.00000Down
NM009917 TC06001313.hg.1FAM20BFamily with sequence similarity 20, member B−5.130.00002Down
NM_001262 TC01000619.hg.1CDKN2CCyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)−4.80.00364Down
NM_003318 TC06000761.hg.1TTKTTK protein kinase−3.70.00008Down
NM_001237 TC04001516.hg.1CCNA2Cyclin A2 (CCNA2)−3.50.00007Down
NM_004701 TC15000449.hg.1CCNB2Cyclin B2 (CCNB2)−2.70.00011Down
NM_005611 TC16000448.hg.1RBL2Retinoblastoma-like 2 (p130)−2.60.00001Down
NM_001178138 TC03001849.hg.1TFDP2Transcription factor Dp-2 (E2F dimerization partner 2)−2.50.00001Down
NM_001786 TC02001182.hg.1CDK1Cyclin-dependent kinase 1−2.50.00163Down
NM_002388 TC06001799.hg.1MCM3Minichromosome maintenance complex component 3−2.50.00000Down
NM_057749 TC08001438.hg.1CCNE2Cyclin E2 (CCNE2)−2.40.00622Down
NM_001042749 TC0X000606.hg.1STAG2Stromal antigen 2 (STAG2−2.20.00017Down
NM_005915 TC02002376.hg.1MCM6Minichromosome maintenance complex component 6−2.10.00019Down
NM_001136197 TC19000070.hg.1FZR1Fizzy/cell division cycle 20 related 1−2.10.00348Down
NM_022809 TC05001829.hg.1CDC25CCell division cycle 25 homolog C−2.10.00092Down

hsa04115:p53 signaling pathway

NM_002392 TC12000606.hg.1MDM2Mdm2, p53 E3 ubiquitin protein ligase homolog13.80.00010Up
NM_008870 TC13000386.hg.1IER3Immediate early response 38.470.00200Up
NM_001199741 TC01000745.hg.1GADD45AGrowth arrest and DNA-damage-inducible, alpha7.90.00006Up
NM_021127 TC18000213.hg.1PMAIP1 Phorbol-12-myristate-13-acetate-induced protein 16.10.00001Up
NM_000389 TC06000532.hg.1CDKN1ACyclin-dependent kinase inhibitor 1A4.40.00015Up
NM_001259 TC07001603.hg.1CDK6Cyclin-dependent kinase 64.30.00013Up
NM_001172477 TC08001496.hg.1RRM2BRibonucleotide reductase M2 B3.70.00015Up
NM_001199933 TC06001997.hg.1SESN1Sestrin 13.60.00004Up
NM_000602 TC07000643.hg.1SERPINE1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 12.20.00406Up
NM_004324 TC19000716.hg.1BAXBCL2-associated X protein2.20.00672Up
NM_001034 TC02000057.hg.1RRM2ribonucleotide reductase M2−2.90.00010Down
NM_002639 TC18000226.hg.1SERPINB5Serpin peptidase inhibitor, clade B (ovalbumin), member 5−2.80.00756Down
NM_001196 TC01000866.hg.1BIDBH3 interacting domain death agonist−2.50.00002Down
NM_016426 TC22000394.hg.1GTSE1G-2 and S-phase expressed 1−2.40.00019Down
NM_003620 TC17000739.hg.1PPM1DProtein phosphatase, Mg2+/Mn2+ dependent, 1D4.50.00005Up
NM_003842 TC08001049.hg.1TNFRSF10BTumor necrosis factor receptor superfamily, member 10b3.80.00005Up
NM_031459 TC01000377.hg.1SESN2Sestrin 23.70.00119Up
NM_003246 TC15000270.hg.1THBS1Thrombospondin 12.50.00013Up
NM_010277 TC66000070.hg.1UBE4BUbiquitination factor E4B−17.440.00000Down
NM_005351 TC62000079.hg.1PLOD1Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1−16.780.00104Down
NM_004701 TC15000449.hg.1CCNB2Cyclin B2−2.70.00011Down
NM_001786 TC02001182.hg.1CDK1Cyclin-dependent kinase 1−2.50.00163Down
NM_057749 TC08001438.hg.1CCNE2Cyclin E2−2.40.00622Down
NM_022470 TC03002022.hg.1ZMAT3Zinc finger, matrin-type 3−2.20.00161Down

hsa04668:TNF signaling pathway

NM_006290 TC06001027.hg.1TNFAIP3Tumor necrosis factor, alpha-induced protein 320.20.00007Up
NM_006941 TC11001948.hg.1TCF19Transcription factor 198.960.00064Up
NM_001168319 TC06000087.hg.1EDN1Endothelin 13.00.00025Up
NM_001145138 TC11001939.hg.1RELAV-rel reticuloendotheliosis viral oncogene homolog A (avian)3.00.00002Up
NM_001244134 TC10002935.hg.1MAP3K8Mitogen-activated protein kinase kinase kinase 82.90.00013Up
NM_000214 TC20000621.hg.1JAG1Jagged 12.70.00019Up
NM_000963 TC01003638.hg.1PTGS2 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)2.60.02677Up
NM_001166 TC11000957.hg.1BIRC2Baculoviral IAP repeat containing 22.30.00069Up
NM_000600 TC05001366.hg.1IL6Interleukin-62.20.00002Up
NM_182810 TC22000317.hg.1ATF4Activating transcription factor 4 (tax-responsive enhancer element B67)2.20.00548Up
NM-029914 TC61000040.hg.1UBIAD1UbiA prenyltransferase domain containing 1−16.880.00108Down
NM_001256045 TC03001824.hg.1PIK3CB Phosphoinositide-3-kinase, catalytic, beta polypeptide−4.70.00000Down
NM_001065 TC12001135.hg.1TNFRSF1ATumor necrosis factor receptor superfamily, member 1A−4.00.00035Down
NM_002758 TC17000807.hg.1MAP2K6Mitogen-activated protein kinase kinase 6−4.00.00021Down
NM_002982 TC17000383.hg.1CCL2Chemokine (C-C motif) ligand 2−2.60.03428Down
NM_001114172 TC01002616.hg.1PIK3R3 Phosphoinositide-3-kinase, regulatory subunit 3 (gamma)−2.30.00083Down
NM_005027 TC19002628.hg.1PIK3R2 Phosphoinositide-3-kinase, regulatory subunit 2 (beta)−2.30.00044Down
NM_001136153 TC06004121.hg.1ATF6BActivating transcription factor 6 beta−2.10.00045Down
NM_001199427 TC14000786.hg.1TRAF3TNF receptor-associated factor 3 (TRAF3)−2.10.00073Down

hsa04152:AMPK signaling pathway

NM_003749 TC13000871.hg.1IRS2Insulin receptor substrate 23.50.00044Up
NM_000875 TC15000949.hg.1IGF1RInsulin-like growth factor 1 receptor3.50.00188Up
NM_181715 TC01003280.hg.1CRTC2CREB regulated transcription coactivator 23.00.00176Up
NM_006253 TC12000936.hg.1PRKAB1Protein kinase, AMP-activated, beta 1 non-catalytic subunit2.70.00031Up
NM_012238 TC10000400.hg.1SIRT1Sirtuin 12.50.00023Up
NM_001018053 TC01001731.hg.1PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 22.40.00008Up
NM_000859 TC05000363.hg.1HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase−4.80.00001Down
NM_001256045 TC03001824.hg.1PIK3CB Phosphoinositide-3-kinase, catalytic, beta polypeptide−4.70.00000Down
NM_005063 TC10000721.hg.1SCDStearoyl-CoA desaturase (delta-9-desaturase)−4.60.00323Down
NM_001237 TC04001516.hg.1CCNA2Cyclin A2−3.50.00007Down
NM_001199756 TC01001771.hg.1PPP2R5AProtein phosphatase 2, regulatory subunit B′, alpha−2.80.00000Down
NM_004104 TC17001973.hg.1FASNFatty acid synthase−2.60.00024Down
NM_198834 TC17001406.hg.1ACACAAcetyl-CoA carboxylase alpha−2.60.00073Down
NM_005027 TC19002628.hg.1PIK3R2 Phosphoinositide-3-kinase, regulatory subunit 2−2.30.00044Down
NM_001114172 TC01002616.hg.1PIK3R3 Phosphoinositide-3-kinase, regulatory subunit 3 (gamma)−2.30.00083Down
NM_005037 TC03000069.hg.1PPARGPeroxisome proliferator-activated receptor gamma−2.10.00108Down
NM_001177562 TC11002284.hg.1PPP2R1BProtein phosphatase 2, regulatory subunit A−2.00.01473Down

hsa04621:NOD-like receptor signaling pathway

NM_006290 TC06001027.hg.1TNFAIP3Tumor necrosis factor, alpha-induced protein 320.20.00007Up
NM_001562 TC11002293.hg.1IL18Interleukin-183.10.00033Up
NM_001145138 TC11001939.hg.1RELAV-rel reticuloendotheliosis viral oncogene homolog A3.00.00002Up
NM_001166 TC11000957.hg.1BIRC2Baculoviral IAP repeat containing 22.30.00069Up
NM_004620 TC11001560.hg.1TRAF6TNF receptor-associated factor 6, E3 ubiquitin protein ligase2.30.00000Up
NM_000600 TC05001366.hg.1IL6Interleukin-62.20.00002Up
NM_001006600 TC05000280.hg.1ERBB2IPErbb2 interacting protein−3.10.00030Down
NM_002982 TC17000383.hg.1CCL2Chemokine (C-C motif) ligand 2−2.60.03428Down
NM_001017963 TC14001526.hg.1HSP90AA1Heat shock protein 90 kDa alpha (cytosolic), class A member 1−2.50.00029Down
Validation of the expression of genes by qPCR

To validate potentially valuable genes that were screened by microarray results, the results between the clustered selected transcripts and those from RT-qPCR were compared (Fig. 2). Following borax treatment, 26 downregulated genes were identified on the basis of fold-change threshold, and the potentially functional correlation of caspase--6 or P53 signaling with proliferation in HepG2 cells was suggested. Additionally, RT-qPCR also revealed a few abundantly expressed genes, including AZI2, BPGM, FBXO9, MBTPS1, NBPF1, PRUNE1, SNX13, SETD5, TSR2, TTLL4, UPF2, RCN2, USP16, PPcaspase-1, MTIF2, MAPK4, LMAN2L, CENPN, CDCA8 and PPIP5K2, in HepG2 cells with no borax treatment.

Effects of abundantly expressed genes on cell proliferation

HepG2 cells infected with recombinant adenovirus were cultured for 48–72 h. When adenoviral green fluorescent protein (AdGFP) reached over 80%, recombinant adenovirus was considered to be efficiently infected HepG2 cells in vitro (Fig. 4), and decreased expression of genes was established following transfection with each shRNA (Fig. 5). On the 5th day following the infection, the proliferation of iRNA-treated HepG2 cells was significantly suppressed (fold change ≥1.5) compared with those in the control group (P<0.05). Furthermore, the target genes of RNAi fragments included PRUNE1, NBPF1, PPcaspase-1, UPF2 and MBTPS1 (fold change ≥1.50; Fig. 6). These findings indicted that, compared with control group cells, cell proliferation in the shRNA group was significantly reduced (fold change ≥1.5). Therefore it was inferred that the target gene of RNA lentivirus in the shRNA group was tumor cells proliferation-related positive gene.

Discussion

Boron is a naturally abundant element on the earth (24). Notably, borax is a boron compound, which plays essential roles in many industries and in daily life (25). Currently, several boron-containing molecules have been applied for the treatment of multiple diseases, including inflammation, diabetes and cancer (26,27). Some of these treatments have produced positive results in preclinical and clinical trials (28,29). For instance, previous studies revealed boric acid/borax mediated protection against TiO2 genotoxicity in peripheral blood cells (30). In addition, borax mediated the stimulation of sister chromatid exchange in human chromosomes and/or lymphocyte proliferation (1). Furthermore, a previous study revealed that peripheral blood cells with aflatoxin B1-induced genetic damage were sufficiently rescued by borax treatment, which has also been indicated to be an effective antiepileptic drug (31,32).

The properties of borax are also considered to be correlated with genetic defects and genotoxicity. Specifically, it is widely accepted that when borax is applied at high concentrations, it is cytotoxic to mammalian cells, although cell transformation assays show that borax treatment is weakly mutagenic and not oncogenic (33). In our previous study, it was indicated that borax induced a strong increase in caspase--6 production, which was accompanied by the enhanced expression of p53-modulated genes, including p21, Bax and Puma (16). Considering that the precise regulation of borax-induced genotoxicity has not been well defined, novel mechanisms underlying the genetic actions and potential new biological effects of borax on various cell-types require more insight.

In the present study, microarray analysis indicated that the expression levels of 530 genes were changed in HepG2 cells in the 2-h treatment group. Among them, 146 were downregulated and 384 were upregulated. Notably, MYO10, one of the downregulated genes, encodes a member of the myosin superfamily, which mediates the migration and invasion of tumor cells, suggesting that it contributes to the metastatic phenotype, possibly via its direct involvement in the assembly of molecular motors (34,35). miR-4521 was also downregulated, which is closely correlated with signal transduction, mediating DNA binding, receptor activity and other processes (36). The DDIT3 gene, which encodes a suppressor protein that primarily inhibits mTOR signaling under stress conditions and is partially involved in cancer progression (37), was also downregulated with borax treatment. Heat shock protein (HSP)25 protein is encoded by the HSPβ-1 gene. HSPβ-1 is a member of the HSP family (38) and is abundantly expressed in various types of cancer associated with poor prognosis and resistance to chemotherapy, possibly through their aggressive tumor behavior and metastasis (39). In the present study, HSPβ-1 was also significantly downregulated. Early growth response protein 1, which is involved in the initial stage of the inflammatory response, possibly through its critical roles as a tumor suppressor or promoter (40), was upregulated following 2-h borax treatment in the present study. Furthermore, prostaglandin-endoperoxide synthase 2, a principal inflammatory mediator and a UV-inducible enzyme the catalyzes the first step in the synthesis of prostaglandin E2 (41), was also upregulated. Additionally, TNFAIP3 and caspase--6, which are associated with inflammation and stress reaction (42), were also found to be upregulated. Notably, TNFAIP3 acts as a critical molecular switch to discriminate tumor necrosis factor-induced NF-κB signaling from the activated JNK signaling pathways in hepatocytes when stimulated with varying cytokine concentrations under normal or pathological conditions (43). These findings implicate downregulated/upregulated genes following borax treatment impact the migration and invasion of tumor cells, DNA binding signal transduction, inflammation and stress reactions. However, the specific mechanisms involved require further study.

The expression levels of 1,763 genes were changed in cells from the 24-h treatment group compared with those in the control group. Specifically, 719 genes were downregulated and 1,044 genes were upregulated (Fig. 1). Among them, the downregulated genes included B3GALT6, a critical enzyme catalyzing the formation of the tetrasaccharide linkage region, the mutation of which results in proteoglycan maturation defects (44). In the present study, FAM20B was downregulated in the 24-h treatment group. Notably, it was previously indicated that FAM20B deletion is associated with Ehlers-Danlos syndrome (45,46). UBE4B was also downregulated in cells from the 24-h treatment group in the present study. A previous study revealed that silencing of UBE4B expression inhibited the proliferation, colony formation, migration and invasion of liver cancer cells in vitro, and resulted in significant apoptosis. Therefore, it was suggested that this gene may be a good prognostic candidate for liver cancer (47). The overexpression of UBE4B, which is widely accepted as a p53 upstream target gene, contributes to the migration and invasion of tumor cells (48,49). UBIAD1, also known as UbiA prenyltransferase domain-containing protein 1, functions as an important regulator in the cell progression of bladder and prostate cancer, as well as vascular integrity, possibly through its modulation of metabolism of intracellular cholesterol and protection against oxidative stress (50). UBIAD1 was also downregulated. Additionally, PLOD1, which is associated with cell apoptosis, cell cycle and metastasis (51), was also found to be downregulated.

In the present study, 24-h treatment with borax upregulated the expression of several genes, including ZNF84, which is also known as a zinc finger transcription factor gene (52). ZNF84 is located in chromosome 12q24.33, which is correlated with recurrent breakpoints and allelic loss in a few types of cancer (52,53). Immediate early response 3 was another upregulated gene that normally regulates apoptosis, proliferation and the maintenance of HCCs (54,55). TCF19, which was also upregulated, has been identified to be a good prognostic candidate for HCC, thereby becoming a promising candidate for preclinical and/or clinical studies to determine its potential risk in HCCs (56).

Distinct sets of genes were found to be altered after different treatment durations, namely, borax treatments for either 2 or 24 h in HepG2 cells. Exposure to borax for 2 h altered the expression levels of genes encoding proteins involved in signal transduction underlying stress response, biopolymer metabolic process, the inflammatory response (e.g., NF-κB and caspase--6) and unfolded protein response among other possibilities. Notably, the results for cells from the 2-h treatment group revealed the disruption of certain metabolic processes involved in inflammation and stress response. Accordingly, borax treatment for 24 h caused the dysregulation of genes involved in a number of signaling pathways, which are associated with enhanced cell proliferation and apoptosis underlying the disruption of both vascular integrity and suppression of tumor cell progression (16), indicating that the disruption of those signaling pathways may contribute to carcinogenesis in borax-treated HepG2 cells.

Enriched GO analyses in the present study revealed that the significantly enriched gene sets included the response to primary metabolic process, response to stimulus, biosynthetic process, developmental process, apoptotic process, immune system process, binding, catalytic activity, cell part, organelles, and others. In the present study, the downregulation of PRUNE1, NBPF1, PPcaspase-1, UPF2, and MBTPS1 suggested that they inhibited the growth of HepG2 cells. For instance, PRUNE1 is a member of the Asp-His-His phosphoesterase protein superfamily, which is involved in cell motility and is implicated in cancer progression (57). NBPF1 is a tumor suppressor in several cancer types and can act as a tumor suppressor modulating cell apoptosis, possibly through the inhibition of various proteins involved in the cell cycle (58). NBPF1 is also implicated in cancer progression (59). PPcaspase-1 has also been reported to be upregulated in human colon cancer cells. Accordingly, small interfering RNA-mediated PPcaspase-1 knockdown resulted in cell apoptosis in those cells (60). Therefore, precise modulations of the expression level of these critical genes leads to accurate regulation of cellular activity, thereby contributing to the suppressed initiation of cancer progression. Notably, future progress in identifying the basic features of these essential proteins may provide further insights into the diagnosis and prognosis of certain types of human cancer and may also aid the production of novel strategies to develop more effective and efficient therapeutic agents against those types of cancer.

To conclude, 2- and 24-h borax treatment caused significant alterations in the expression levels of various genes. However, based on the length of treatment different sets of genes were altered. Dysregulated genes were identified to be involved in various critical signaling pathways underlying biological processes, including the inflammatory response, stress response, cell apoptosis, signal transduction and cell-to-cell signaling. Some of these changes in those biological processes persisted 24 h after treatment. Thus, it was demonstrated that borax could induce significant alterations in gene expression. However, further studies are required to determine whether these changes are ascribed to genetic alterations in the promoter or regulatory regions of dysregulated genes. Notably, these studies could bring further insights into how borax affects gene expression. The present study provides the fundamental basis for exploring the carcinogenicity of borax treatment in HepG2 to reveal the underlying cellular and molecular mechanisms, the basic biological characteristics and associated pathways, which warrant further investigation.

Acknowledgements

Not applicable.

Funding

This work was funded by the National Natural Scientific Foundation of China (grant no. 81872509), the Natural Science Foundation of Hubei Provincial Department of Education (grant no. D20172101), the Hubei Provincial Technology Innovation Project (grant no. 2017ACA176), the Hubei Province Health and Family Planning Scientific Research Project (grant no. WJ2019M054), the Natural Science Foundation of Hubei Provincial Department of Education (grant no. Q20162113) and the Natural Science Foundation of the Bureau of Science and Technology of Shiyan City (grant no. 18Y76, 17Y47).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LW, YW, ZGT and YSZ conceived and designed the experiments. LW, ZPZ, JZ, HMW, GMW and SW contributed reagents, materials and analysis tools and performed the experiments. LW, WBZ, QHC, LHY and MXL analyzed and interpreted the experimental data. LW was a major contributor in writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Routray I and Ali S: Boron induces lymphocyte proliferation and modulates the priming effects of lipopolysaccharide on macrophages. PLoS One. 11:e01506072016. View Article : Google Scholar : PubMed/NCBI

2 

Neiner D, Sevryugina YV, Harrower LS and Schubert DM: Structure and properties of sodium enneaborate, Na2[B8O11(OH)4]·B(OH)3·2H2O. Inorg Chem. 56:7175–7181. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Alak G, Parlak V, Yeltekin AÇ, Ucar A, Çomaklı S, Topal A, Atamanalp M, Özkaraca M and Türkez H: The protective effect exerted by dietary borax on toxicity metabolism in rainbow trout (Oncorhynchus mykiss) tissues. Comp Biochem Physiol C Toxicol Pharmacol. 216:82–92. 2019. View Article : Google Scholar : PubMed/NCBI

4 

Alak G, Parlak V, Aslan ME, Ucar A, Atamanalp M and Turkez H: Borax supplementation alleviates hematotoxicity and DNA damage in rainbow trout (Oncorhynchus mykiss) exposed to copper. Biol Trace Elem Res. 187:536–542. 2019. View Article : Google Scholar : PubMed/NCBI

5 

Hussain SA, Abood SJ and Gorial FI: The adjuvant use of calcium fructoborate and borax with etanercept in patients with rheumatoid arthritis: Pilot study. J Intercult Ethnopharmacol. 6:58–64. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Ince S, Kucukkurt I, Cigerci IH, Fatih Fidan A and Eryavuz A: The effects of dietary boric acid and borax supplementation on lipid peroxidation, antioxidant activity, and DNA damage in rats. J Trace Elem Med Biol. 24:161–164. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Sandeep Varma R, Shamsia S, Thiyagarajan OS, Vidyashankar S and Patki PS: Yashada bhasma (Zinc calx) and Tankana (Borax) inhibit Propionibacterium acne and suppresses acne induced inflammation in vitro. Int J Cosmet Sci. 36:361–368. 2014. View Article : Google Scholar : PubMed/NCBI

8 

López-Cabrera Y, Castillo-García EL, Altamirano-Espino JA, Pérez-Capistran T, Farfán-García ED, Trujillo-Ferrara JG and Soriano-Ursúa MA: Profile of three boron-containing compounds on the body weight, metabolism and inflammatory markers of diabetic rats. J Trace Elem Med Biol. 50:424–429. 2018. View Article : Google Scholar : PubMed/NCBI

9 

Geyikoglu F and Turkez H: Boron compounds reduce vanadium tetraoxide genotoxicity in human lymphocytes. Environ Toxicol Pharmacol. 26:342–347. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Gülsoy N, Yavas C and Mutlu Ö: Genotoxic effects of boric acid and borax in zebrafish, Danio rerio using alkaline comet assay. EXCLI J. 14:890–899. 2015.PubMed/NCBI

11 

Sarkar PK, Prajapati PK, Shukla VJ and Ravishankar B: Evaluation of processed borax as antidote for aconite poisoning. J Ethnopharmacol. 205:138–146. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Capkin E, Ozcelep T, Kayis S and Altinok I: Antimicrobial agents, triclosan, chloroxylenol, methylisothiazolinone and borax, used in cleaning had genotoxic and histopathologic effects on rainbow trout. Chemosphere. 182:720–729. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Pongsavee M: Genotoxic effects of borax on cultured lymphocytes. Southeast Asian J Trop Med Public Health. 40:411–418. 2009.PubMed/NCBI

14 

Pongsavee M: Effect of borax on immune cell proliferation and sister chromatid exchange in human chromosomes. J Occup Med Toxicol. 4:272009. View Article : Google Scholar : PubMed/NCBI

15 

Çelikezen FÇ, Toğar B, Özgeriş FB, İzgi MS and Türkez H: Cytogenetic and oxidative alterations after exposure of cultured human whole blood cells to lithium metaborate dehydrate. Cytotechnology. 68:821–827. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Wei Y, Yuan FJ, Zhou WB, Wu L, Chen L, Wang JJ and Zhang YS: Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax. Genet Mol Res. 15:2016. View Article : Google Scholar :

17 

Brocato J and Costa M: Basic mechanics of DNA methylation and the unique landscape of the DNA methylome in metal-induced carcinogenesis. Crit Rev Toxicol. 43:493–514. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Hazman Ö, Bozkurt MF, Fidan AF, Uysal FE and Çelik S: the effect of boric acid and borax on oxidative stress, inflammation, ER stress and apoptosis in cisplatin toxication and nephrotoxicity developing as a result of toxication. Inflammation. 41:1032–1048. 2018. View Article : Google Scholar : PubMed/NCBI

19 

Oh SH and Lim SC: A rapid and transient ROS generation by cadmium triggers apoptosis via caspase-dependent pathway in HepG2 cells and this is inhibited through N-acetylcysteine-mediated catalase upregulation. Toxicol Appl Pharmacol. 212:212–223. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Cartularo L, Laulicht F, Sun H, Kluz T, Freedman JH and Costa M: Gene expression and pathway analysis of human hepatocellular carcinoma cells treated with cadmium. Toxicol Appl Pharmacol. 288:399–408. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Zhang DY, Liu Z, Lu Z, Sun WL, Ma X, Zhang P, Wu BQ and Cui PY: Lentivirus-mediated overexpression of HSDL2 suppresses cell proliferation and induces apoptosis in cholangiocarcinoma. Onco Targets Ther. 11:7133–7142. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Zheng J, You W, Zheng C, Wan P, Chen J, Jiang X, Zhu Z, Zhang Z, Gong A, Li W, et al: Knockdown of FBXO39 inhibits proliferation and promotes apoptosis of human osteosarcoma U-2OS cells. Oncol Lett. 16:1849–1854. 2018.PubMed/NCBI

24 

Yamada KE and Eckhert CD: Boric acid activation of eIF2α and Nrf2 Is PERK dependent: A mechanism that explains how boron prevents DNA damage and enhances antioxidant status. Biol Trace Elem Res. 188:2–10. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Matencio A, Navarro-Orcajada S, García-Carmona F and López-Nicolás JM: Ellagic acid-borax fluorescence interaction: Application for novel cyclodextrin-borax nanosensors for analyzing ellagic acid in food samples. Food Funct. 9:3683–3687. 2018. View Article : Google Scholar : PubMed/NCBI

26 

Donoiu I, Militaru C, Obleagă O, Hunter JM, Neamţu J, Biţă A, Scorei IR and Rogoveanu OC: Effects of boron-containing compounds on cardiovascular disease risk factors-a review. J Trace Elem Med Biol. 50:47–56. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Worm DJ, Els-Heindl S, Kellert M, Kuhnert R, Saretz S, Koebberling J, Riedl B, Hey-Hawkins E and Beck-Sickinger AG: A stable meta-carborane enables the generation of boron-rich peptide agonists targeting the ghrelin receptor. J Pept Sci. 24:e31192018. View Article : Google Scholar : PubMed/NCBI

28 

Rico P, Rodrigo-Navarro A and Salmerón-Sánchez M: Borax-Loaded PLLA for promotion of myogenic differentiation. Tissue Eng Part A. 21:2662–2672. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Das BC, Thapa P, Karki R, Schinke C, Das S, Kambhampati S, Banerjee SK, Van Veldhuizen P, Verma A, Weiss LM and Evans T: Boron chemicals in diagnosis and therapeutics. Future Med Chem. 5:653–676. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Turkez H: Effects of boric acid and borax on titanium dioxide genotoxicity. J Appl Toxicol. 28:658–664. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Jensen JP: The rise and fall of borax as an antiepileptic drug. Arch Neurol. 63:621–622. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Meyer-Hamme G, Beckmann K, Radtke J, Efferth T, Greten HJ, Rostock M and Schröder S: A survey of chinese medicinal herbal treatment for chemotherapy-induced oral mucositis. Evid Based Complement Alternat Med. 2013:2849592013. View Article : Google Scholar : PubMed/NCBI

33 

Landolph JR: Cytotoxicity and negligible genotoxicity of borax and borax ores to cultured mammalian cells. Am J Ind Med. 7:31–43. 1985. View Article : Google Scholar : PubMed/NCBI

34 

Chen CP, Sun ZL, Lu X, Wu WX, Guo WL, Lu JJ, Han C, Huang JQ and Fang Y: MiR-340 suppresses cell migration and invasion by targeting MYO10 in breast cancer. Oncol Rep. 35:709–716. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Makowska KA, Hughes RE, White KJ, Wells CM and Peckham M: Specific myosins control actin organization, cell morphology, and migration in prostate cancer cells. Cell Rep. 13:2118–2125. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Zhang H, He P, Huang R, Sun L, Liu S, Zhou J, Guo Y, Yang D and Xie P: Identification and bioinformatic analysis of dysregulated microRNAs in human oligodendroglial cells infected with borna disease virus. Mol Med Rep. 14:4715–4722. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Pinto JA, Rolfo C, Raez LE, Prado A, Araujo JM, Bravo L, Fajardo W, Morante ZD, Aguilar A, Neciosup SP, et al: In silico evaluation of DNA Damage Inducible Transcript 4 gene (DDIT4) as prognostic biomarker in several malignancies. Sci Rep. 7:15262017. View Article : Google Scholar : PubMed/NCBI

38 

Shatov VM, Weeks SD, Strelkov SV and Gusev NB: The role of the arginine in the conserved N-terminal domain RLFDQxFG motif of human small heat shock proteins HspB1, HspB4, HspB5, HspB6, and HspB8. Int J Mol Sci. 19(pii): E21122018. View Article : Google Scholar : PubMed/NCBI

39 

Konda JD, Olivero M, Musiani D, Lamba S and Di Renzo MF: Heat-shock protein 27 (HSP27, HSPB1) is synthetic lethal to cells with oncogenic activation of MET, EGFR and BRAF. Mol Oncol. 11:599–611. 2017. View Article : Google Scholar : PubMed/NCBI

40 

Mohamad T, Kazim N, Adhikari A and Davie JK: EGR1 interacts with TBX2 and functions as a tumor suppressor in rhabdomyosarcoma. Oncotarget. 9:18084–18098. 2018. View Article : Google Scholar : PubMed/NCBI

41 

Li H, Wang J, Liu X and Cheng Q: MicroRNA-204-5p suppresses caspase-6-mediated inflammatory response and chemokine generation in HK-2 renal tubular epithelial cells by targeting caspase-6R. Biochem Cell Biol. 97:109–117. 2019. View Article : Google Scholar : PubMed/NCBI

42 

Zhai Y, Lin P, Feng Z, Lu H, Han Q, Chen J, Zhang Y, He Q, Nan G, Luo X, et al: TNFAIP3-DEPTOR complex regulates inflammasome secretion through autophagy in ankylosing spondylitis monocytes. Autophagy. 14:1629–1643. 2018. View Article : Google Scholar : PubMed/NCBI

43 

Pinna F, Bissinger M, Beuke K, Huber N, Longerich T, Kummer U, Schirmacher P, Sahle S and Breuhahn K: A20/TNFAIP3 discriminates tumor necrosis factor (TNF)-Induced NF-κB from JNK pathway activation in hepatocytes. Front Physiol. 8:6102017. View Article : Google Scholar : PubMed/NCBI

44 

Wen J, Xiao J, Rahdar M, Choudhury BP, Cui J, Taylor GS, Esko JD and Dixon JE: Xylose phosphorylation functions as a molecular switch to regulate proteoglycan biosynthesis. Proc Natl Acad Sci USA. 111:15723–15728. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Taylan F and Mäkitie O: Abnormal proteoglycan synthesis due to gene defects causes skeletal diseases with overlapping phenotypes. Horm Metab Res. 48:745–754. 2016. View Article : Google Scholar : PubMed/NCBI

46 

Van Damme T, Pang X, Guillemyn B, Gulberti S, Syx D, De Rycke R, Kaye O, de Die-Smulders CEM, Pfundt R, Kariminejad A, et al: Biallelic B3GALT6 mutations cause spondylodysplastic Ehlers-Danlos syndrome. Hum Mol Genet. 27:3475–3487. 2018. View Article : Google Scholar : PubMed/NCBI

47 

Zhang XF, Pan QZ, Pan K, Weng DS, Wang QJ, Zhao JJ, He J, Liu Q, Wang DD, Jiang SS, et al: Expression and prognostic role of ubiquitination factor E4B in primary hepatocellular carcinoma. Mol Carcinog. 55:64–76. 2016. View Article : Google Scholar : PubMed/NCBI

48 

Periz G, Lu J, Zhang T, Kankel MW, Jablonski AM, Kalb R, McCampbell A and Wang J: Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription. PLoS Biol. 13:e10021142015. View Article : Google Scholar : PubMed/NCBI

49 

Wang B, Wu H, Chai C, Lewis J, Pichiorri F, Eisenstat DD, Pomeroy SL and Leng RP: MicroRNA-1301 suppresses tumor cell migration and invasion by targeting the p53/UBE4B pathway in multiple human cancer cells. Cancer Lett. 401:20–32. 2017. View Article : Google Scholar : PubMed/NCBI

50 

Okano T: A new horizon in vitamin K research. Yakugaku Zasshi. 136:1141–1159. 2016.(In Japanese). View Article : Google Scholar : PubMed/NCBI

51 

Li L, Wang W, Li X and Gao T: Association of ECRG4 with PLK1, CDK4, PLOD1 and PLOD2 in esophageal squamous cell carcinoma. Am J Transl Res. 9:3741–3748. 2017.PubMed/NCBI

52 

Rosati M, Rocchi M, Storlazzi CT and Grimaldi G: Assignment to chromosome 12q24.33, gene organization and splicing of the human KRAB/FPB containing zinc finger gene ZNF84. Cytogenet Cell Genet. 94:127–130. 2001. View Article : Google Scholar : PubMed/NCBI

53 

Assou S, Cerecedo D, Tondeur S, Pantesco V, Hovatta O, Klein B, Hamamah S and De Vos J: A gene expression signature shared by human mature oocytes and embryonic stem cells. BMC Genomics. 10:102009. View Article : Google Scholar : PubMed/NCBI

54 

Zhou Q, Hahn JK, Neupane B, Aidery P, Labeit S, Gawaz M and Gramlich M: Dysregulated ier3 expression is associated with enhanced apoptosis in titin-based dilated cardiomyopathy. Int J Mol Sci. 18(pii): E7232017. View Article : Google Scholar : PubMed/NCBI

55 

Tran DDH, Koch A, Allister A, Saran S, Ewald F, Koch M, Nashan B and Tamura T: Treatment with MAPKAP2 (MK2) inhibitor and DNA methylation inhibitor, 5-aza dC, synergistically triggers apoptosis in hepatocellular carcinoma (HCC) via tristetraprolin (TTP). Cell Signal. 28:1872–1880. 2016. View Article : Google Scholar : PubMed/NCBI

56 

Mathew S, Abdel-Hafiz H, Raza A, Fatima K and Qadri I: Host nucleotide polymorphism in hepatitis B virus-associated hepatocellular carcinoma. World J Hepatol. 8:485–498. 2016. View Article : Google Scholar : PubMed/NCBI

57 

Zollo M, Ahmed M, Ferrucci V, Salpietro V, Asadzadeh F, Carotenuto M, Maroofian R, Al-Amri A, Singh R, Scognamiglio I, et al: PRUNE is crucial for normal brain development and mutated in microcephaly with neurodevelopmental impairment. Brain. 140:940–952. 2017. View Article : Google Scholar : PubMed/NCBI

58 

Li D, Li P, Wu J, Yi J, Dou Y, Guo X, Yin Y, Wang D, Ma C and Qiu L: Methylation of NBPF1 as a novel marker for the detection of plasma cell-free DNA of breast cancer patients. Clin Chim Acta. 484:81–86. 2018. View Article : Google Scholar : PubMed/NCBI

59 

Andries V, Vandepoele K, Staes K, Berx G, Bogaert P, Van Isterdael G, Ginneberge D, Parthoens E, Vandenbussche J, Gevaert K and van Roy F: NBPF1, a tumor suppressor candidate in neuroblastoma, exerts growth inhibitory effects by inducing a G1 cell cycle arrest. BMC Cancer. 15:3912015. View Article : Google Scholar : PubMed/NCBI

60 

Stegmann CM, Lührmann R and Wahl MC: The crystal structure of PPcaspase-1 bound to cyclosporine A suggests a binding mode for a linear epitope of the SKIP protein. PLoS One. 5:e100132010. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July 2019
Volume 42 Issue 1

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Wu, L., Wei, Y., Zhou, W., Zhang, Y., Chen, Q., Liu, M. ... Tang, Z. (2019). Gene expression alterations of human liver cancer cells following borax exposure. Oncology Reports, 42, 115-130. https://doi.org/10.3892/or.2019.7169
MLA
Wu, L., Wei, Y., Zhou, W., Zhang, Y., Chen, Q., Liu, M., Zhu, Z., Zhou, J., Yang, L., Wang, H., Wei, G., Wang, S., Tang, Z."Gene expression alterations of human liver cancer cells following borax exposure". Oncology Reports 42.1 (2019): 115-130.
Chicago
Wu, L., Wei, Y., Zhou, W., Zhang, Y., Chen, Q., Liu, M., Zhu, Z., Zhou, J., Yang, L., Wang, H., Wei, G., Wang, S., Tang, Z."Gene expression alterations of human liver cancer cells following borax exposure". Oncology Reports 42, no. 1 (2019): 115-130. https://doi.org/10.3892/or.2019.7169