microRNA-21 overexpression contributes to cell proliferation by targeting PTEN in endometrioid endometrial cancer

  • Authors:
    • Xiaoyan Qin
    • Lei Yan
    • Xingbo Zhao
    • Chunyan Li
    • Yibing Fu
  • View Affiliations

  • Published online on: September 6, 2012     https://doi.org/10.3892/ol.2012.896
  • Pages: 1290-1296
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of this study was to investigate the role of microRNA-21 (miR-21) in the regulation of phosphatase and tensin homolog deleted from chromosome-10 (PTEN) expression and proliferation of endometrioid endometrial cancer (EEC) cells. We performed a qRT-PCR assay with miR-21 and PTEN in 16 paired EEC tumor tissues and adjacent non-tumor endometrium. To investigate the regulation of PTEN by miR-21, we designed gain- and loss-of-function of miR-21 experiments in the KLE cell line by transfection with a synthetic miR-21 mimic and inhibitor. To validate the putative binding site of miR-21 in the 3' untranslated region (3'-UTR) of PTEN messenger RNA (mRNA), a dual-luciferase reporter assay was carried out. To evaluate the potential effect of miR-21 on EEC proliferation, we performed both overexpression experiments, using an miR-21 mimic, and inhibition assays, using an miR-21 inhibitor. miR-21 was overexpressed in EEC and was inversely correlated with PTEN protein expression (P<0.001). miR-21 regulated PTEN protein expression and cell proliferation in the KLE cell line and the direct binding of miR-21 to the PTEN 3'-UTR was confirmed using a dual-luciferase reporter assay. The upregulation of miR-21 led to a significant decrease in the PTEN protein expression level (P=0.007). The downregulation of miR-21 led to a significant increase in PTEN protein (P=0.002). The expression of luciferase in the wt-PTEN-3'-UTR-pGL3 group was downregulated in the presence of the miR-21 mimic (P=0.001). miR-21 was overexpressed in EEC. In conclusion, we demonstrated that the expression of PTEN protein, but not mRNA, was negatively directly regulated by miR-21 in the KLE cell line. The overexpression of miR-21 modulated EEC cell proliferation through the downregulation of PTEN.

Introduction

Endometrial cancer is the most common malignancy of the female genital tract in Western countries, with an estimated 43,470 cases and 7,950 mortalities due to the disease expected in the United States in 2010 (1). Of these cancers, 80–90% are endometrioid endometrial cancer (EEC). Phosphatase and tensin homolog deleted from chromosome-10 (PTEN) is a tumor-suppressor gene. Functional inactivation of PTEN has been associated with EEC initiation and progression. A previous study reported a 34–55% somatic mutation frequency of the PTEN gene with a 50–83% frequency of loss or decrease of the PTEN protein (2) in EEC. Thus, PTEN inactivation in EEC and in several other tumor types cannot be explained solely by observed mutations (3). However, the mechanism involved in the inactivation of PTEN is largely unknown.

microRNAs (miRNAs), whose final product is a 19–22 nt functional RNA molecule, are a class of short non-coding RNAs and play important regulatory roles by sequence-specific base pairing on the 3′ untranslated region (3′-UTR) of target messenger RNAs (mRNAs), promoting mRNA degradation or inhibiting translation (4). In addition, a widespread dysregulation of miRNAs is commonly observed in human cancer and promotes cellular transformation and tumorigenesis. miRNAs may function as oncogenes or tumor suppressors in tumor development (5). Specifically, miR-21 has been found to be overexpressed in numerous different solid tumors. Altered miR-21 has been found to be associated with the proliferation, invasion and apoptosis of malignant cells by targeting and downregulating a number of tumor suppressors, including PTEN (6,7), programmed cell death 4 (PDCD4) (811), bcl-2 and tropomyosin l (TPM1) (1213), bone morphogenetic protein receptor II (BMPRII) (14) and sprouty 2 (SPRY2) (15). These findings imply that miR-21 plays a fundamental role in malignant behavior and transformation. A recent study reported that upregulated miR-21 was correlated with EEC (16). However, the authors did not show evidence of the role that miR-21 may play in EEC and whether or not this occurs through the PTEN pathway. Therefore, we designed this study with the aim of investigating the oncogenic role of miR-21 in the process of EEC and in the possible regulation of PTEN expression.

Materials and methods

Tissues and cell line

Paired fresh tumor tissue and matched adjacent non-tumor tissues (>2 cm from the tumor) were obtained from 16 untreated EEC patients (aged from 33 to 72 years, with a mean age of 53.63±9.79) who underwent surgery in our hospital. The samples were snap-frozen in liquid nitrogen, and appropriate informed consent and approval from the Human Research Ethics Committee were obtained. The risk factors of these patients included obesity and anovulation. The tissues were carefully dissected by the pathologist.

The PTEN-positive KLE cell line was obtained from the Type Culture Collection of the Chinese Academy of Sciences (Beijing, China) and was cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Hyclone, South Logan, UT, USA) supplemented with 10% fetal bovine serum (Hyclone) and 100 U/ml penicillin/streptomycin. The cultures were maintained at 37°C in a 5% CO2 humidified chamber.

Transfection with miR-21 mimic and inhibitor

Mature hsa-miR-21 mimic, hsa-miR-21 inhibitor and their respective miRNA scrambled control (SC; Table I) were designed and chemically synthesized by GenePharma (Shanghai, China). 5x105 KLE cells were seeded in 6-well plates (Corning, Lowell, MA, USA) and cultured in antibiotic-free medium for 48 h to achieve >70% confluence on the day of transfection. The miR-21 mimic, inhibitor or their respective SC (40 nM) was transfected into cells using Lipofectamine™ 2000 Reagent (Invitrogen, Carlsbad, CA, USA) in serum-free conditions for 6 h before changing to complete medium. The efficiency of transfection was determined using a Leica DMIRE2 microscope system (Leica Microsystemes, Montreal, QC, Canada). RNA and protein were collected 48 and 72 h after transfection, respectively.

Table I.

Sequences of miR-21 mimic, inhibitor and scrambled controls.

Table I.

Sequences of miR-21 mimic, inhibitor and scrambled controls.

NameSequence (5′-3′)
hsa-miR-21 mimic
  Sense UAGCUUAUCAGACUGAUGUUGA
  Antisense AACAUCAGUCUGAUAAGCUAUU
SC for miR-21 mimic
  Sense UUCUCCGAACGUGUCACGUTT
  Antisense ACGUGACACGUUCGGAGAATT
hsa-miR-21 inhibitor UCAACAUCAGUCUGAUAAGCUA
SC for miR-21 inhibitor CAGUACUUUUGUGUAGUACAA

[i] SC, scrambled control.

RNA extraction and qRT-PCR assay

To test the expression of miRNA-21 and PTEN mRNA in EEC tissues and the KLE cell line, qRT-PCR was carried out using the ABI 7500 Real Time PCR system (Applied Biosystems, Foster City, CA, USA). For detecting mature miR-21, reverse transcription and quantitative PCR were performed using the Hairpin-it™ miRNAs qPCR Quantitation kit (GenePharma). U6 small nuclear RNA (snRNA) expression was assayed for normalization. The thermal cycling conditions for miR-21 and U6 snRNA consisted of 95°C for 3 min, 40 cycles of 95°C for 12 sec and 62°C for 1 min. To detect PTEN mRNA, the RevertAid™ First Strand cDNA Synthesis kit (MBI Fermentas, Burlington, ON, Canada) was used and SYBR® Premix Ex Taq™ II (Takara, Dalian, China) was used (primers shown in Table II). The conditions for the PTEN and GAPDH reaction mixtures were 95°C for 2 min, 40 cycles of 95°C for 15 sec and 60°C for 1 min and finally 95°C for 15 sec, 60°C for 1 min, 95°C for 15 sec and 60°C for 15 sec. All experiments were performed in triplicate. Analysis of relative miR-21 and PTEN mRNA expression was performed using the comparative CT method with U6 and GAPDH snRNA as endogenous controls, respectively.

Table II.

Primers used in the qRT-PCR assay.

Table II.

Primers used in the qRT-PCR assay.

Primer nameSequence (5′-3′)
PTEN (accession no. NM_000314)
  Forward GCGTGCAGATAATGACAAGG
  Reverse GGATTTGACGGCTCCTCTAC
GAPDH (accession no. NM_002046)
  Forward CAAGGTCATCCATGACAACTTTG
  Reverse GTCCACCACCCTGTTGCTGTAG
Western blot analysis

Protein was extracted from the tissue samples and cells 72 h after transfection using a protein extraction reagent (Beyotime, Shanghai, China) and protein concentration was measured using the BCA Protein Assay kit (Beyotime). The proteins (60 μg) were separated on 10% SDS-polyacrylamide gels and transferred to nitrocellulose filter membranes (Hybond, Escondido, CA, USA). The membrane was blocked with Tris-buffered saline Tween-20 (TBST) containing 5% skimmed milk powder for 1 h at room temperature, followed by incubation in TBST containing 5% BSA (Sigma, St. Louis, MO, USA) and primary antibodies overnight at 4°C. Primary antibodies were detected using a peroxidase-coupled goat anti-rabbit secondary antibody (1:8000, ZSBio, Beijing, China) and EZ-ECL chemiluminescence Detection kit for HRP (Biological Industries, Beit-Haemek, Israel). The following primary antibodies were used: rabbit mAb PTEN (1:1000, Cell Signaling Technology, Danvers, MA, USA) and rabbit pAb β-actin (1:1000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA).

Cell proliferation assay

Aberrant cell proliferation is a hallmark of cancer. For proliferation assays, KLE cells were seeded in 96-well plates at 4,000 cells/well and, after 48 h, were transfected with one of the following oligonucleotides: hsa-miR-21 mimic, hsa-miR-21 inhibitor and their respective SCs, using Lipofectamine 2000 Reagent. Cell proliferation was measured at 24, 48 and 72 h after transfection, respectively, using the Cell Counting Kit-8 assay (CCK-8, Boster, Wuhan, China). The proliferation analysis of each group in each individual experiment and the whole experiment process were performed in triplicate.

pGL3-PTEN-3′-UTR luciferase reporter assay

Using the computational algorithm RNA22 microRNA target detection (http://cbcsrv.watson.ibm.com/rna22.html), we characterized the putative binding sites in the 3′-UTR of PTEN mRNA. The fragment of the 3′-UTR of PTEN containing the putative miR-21 binding site was amplified from human genomic DNA by PCR, cloned into the Xba1 site downstream of the luciferase reporter gene of the pGL3-Control vector (Promega, Madison, WI, USA) and named wt-PTEN-3′-UTR-pGL3. For the control, we introduced three point mutations into the seed region of the miR-21 binding sites and named the vector mu-PTEN-3′-UTR-pGL3. KLE cells were seeded in 24-well plates (1×105 cells/well). After 48 h, the cells were co-transfected with wt-PTEN-3′-UTR-pGL3 or mu-PTEN-3′-UTR-pGL3 vectors, pRL-TK Renilla Luciferase Reporter Vector (Promega), hsa-miR-21 mimic, hsa-miR-21 inhibitor or their respective SC using Lipofectamine 2000 Reagent. Luciferase activities were measured using the Dual-Luciferase® Reporter Assay system (Promega) 48 h after transfection. The firefly luciferase activity was normalized to renilla luciferase actvity for each sample. All the experiments were performed in triplicate

Statistical analysis

Statistical analysis was performed using SPSS 13.0. Data are expressed as the mean ± standard error of the mean (SEM) of three independent experiments. Pearson’s product-moment correlation coefficient was used to assess the correlation between PTEN mRNA and protein levels and miR-21 levels in EEC. A paired Student’s t-test was used to evaluate differences between two groups. Multiple group comparisons were analyzed using ANOVA with a post hoc test. P<0.05 was considered to indicate a statistically significant result.

Results

Inverse correlation of miR-21 levels with PTEN protein expression in EEC

miR-21 was overexpressed in all 16 EEC tumor tissues compared with the matched adjacent non-tumor tissues (Fig. 1A, Table III). The average fold change of miR-21 was 2.985-fold (range, 1.021–7.402-fold; SEM, 0.419) higher in EEC tumor tissue versus non-tumor tissues. Compared with the non-tumor tissues, the EEC tumor tissue expressed a significantly lower level of PTEN protein (1.02±0.06 vs. 0.57±0.08, P=0.022, paired Student’s t-test, Fig. 1B). Fig.1C reveals representative gels for PTEN protein levels in 8 pairs of tumor tissues and matched non-tumor tissues from EEC patients. A significantly lower level of PTEN mRNA was observed (7.84±0.82x10−3 vs. 5.75±0.58x10−3, P=0.047, paired Student’s t-test, Fig. 1D). Furthermore, a significant inverse correlation was observed between miR-21 and PTEN protein expression (Fig. 1E), but not between miR-21 and PTEN mRNA expression (Pearson’s correlation=0.453, P=0.078).

Table III.

miR-21 expression and clinicopathological factors.

Table III.

miR-21 expression and clinicopathological factors.

Clinicopathological factorsnmiR-21/U6 snRNA (mean ± SEM; x10−4)
Clinical stage
  I82.62±0.33
  II44.81±0.15
  III47.38±0.82
Histological grade
  G131.78±0.43
  G294.54±0.48
  G345.88±1.55
Lymph node metastasis
  Negative143.80±1.06
  Positive28.28±0.46
Myometrial invasion
  <1/2 myometrial thickness103.45±0.58
  >1/2 myometrial thickness65.86±0.90
miR-21 mimic suppresses and miR-21 inhibitor enhances PTEN protein levels without affecting mRNA levels in EEC

To investigate the regulation of miR-21 to PTEN, we designed experiments of gain- and loss-of-function of miR-21 in the KLE cell line. An miR-21 mimic, inhibitor or their respective SC were transfected into KLE cells and the efficiency of transfection was ∼90%. As shown in Fig. 2A, the administration of miR-21 mimic resulted in a 6.898±0.312-fold upregulation (P=0.003) and administration of the miR-21 inhibitor resulted in a 33.4±5.4% decrease (P=0.007) in miR-21 expression. However, there was no significant difference between SCs and negative control (P=0.862 for miR-21 mimic SC compared with negative control and P=0.953 for miR-21 inhibitor SC compared with negative control).

In western blot analysis, the upregulation of miR-21 in the miR-21 mimic-transfected group led to a significant decrease in PTEN protein expression level, to 53.8±1.6% of that of the control (P=0.007), and the downregulation of miR-21 in the miR-21 inhibitor-transfected group led to a significant increase in PTEN protein level, to 1.888±0.085-fold that of the control (P=0.002, Fig. 2B and C); however, there was no significant difference between SC and negative control P=0.517 for the miR-21 mimic SC compared with negative control and P=0.315 for miR-21 inhibitor SC compared with negative control). In qRT-PCR analysis, no statistically significant change in PTEN mRNA expression was observed among those groups (P>0.05, Fig. 2D). These results indicated that the expression of PTEN protein, but not mRNA, was regulated by miR-21 in KLE cells.

miR-21 directly targets the 3′-UTR of PTEN mRNA

To validate the putative direct binding site of miR-21 in the 3′-UTR of PTEN mRNA, a dual-luciferase reporter assay was carried out. The putative binding sites characterized by the computational algorithm RNA22 microRNA target detection are shown in Fig. 3A. The results of the luciferase assay revealed that, compared with negative control and SCs, the expression of luciferase in the wt-PTEN-3′-UTR-pGL3 group was downregulated to 62.93% of that of the control in the presence of the miR-21 mimic (both P=0.001, Fig. 3B). The effect was reversed (luciferase expression 95.89% of that of the control) when three point mutations were introduced to the seed region of the miR-21 binding sites (Fig. 3B) and rescued (90.43%) by administration of the miR-21 inhibitor (Fig. 3C). Taken together, these results confirm that PTEN is directly regulated by miR-21 in the KLE cell line.

Overexpression of miR-21 increases and inhibition of miR-21 decreases cell proliferation

To evaluate the potential oncogenic effect of miR-21 on endometrial tumor cell proliferation, we performed an overexpression study, using an miR-21 mimic, and an inhibition study, with an miR-21 inhibitor. In the KLE cell line, the miR-21 mimic increased and miR-21 inhibitor decreased cell proliferation significantly (Fig. 4). These results indicate that the expression of miR-21 modulates endometrial tumor cell proliferation.

Discussion

The altered expression of miRNAs, including miR-21, has been found to be associated with various disorders, most specifically with cancer (615). The over- or underexpression of miRNAs is thought to result in down- or upregulation of the protein product of the target genes, thus affecting various biological behaviors of tumorigenesis (4). miRNA microarray analyses have shown that a series of miRNAs are highly expressed in EEC. For example, the miR-200 family has been reported to be highly expressed in EEC compared with normal endometrial tissues and may play an important role in cancer growth (17). In uterine disorders, miR-21 has been found to be associated with endometriosis, leiomyoma and cervical cancer (18,19). However, the exact role of miR-21 in EEC is not fully understood.

In the present study, quantitative RT-PCR assay confirmed that miR-21 was overexpressed in EEC tissues compared with their adjacent matched non-tumor endometrium. This was consistent with the results of the study by Torres et al (16). However, the results were not supported by previous miRNA profiling studies showing the dysregulated miRNAs in tumorous endometrium (20). This may be due to most of the studies not including paired self-controls and there may be individual differences in miRNA expressions. Our self-control study overcame this disadvantage. Moreover, the qRT-PCR technique only detects mature miRNAs, but the microarray technique detects both precursor and mature miRNAs (21). We also revealed a trend that miR-21 expression may be correlated with advanced clinical stages, deep myometrial invasion and high histological grade, which was not consistent with the results of the study by Torres et al (16). However, larger sample numbers and further studies are required to reveal the clinical relevance of these results. Furthermore, miR-21 has been shown to be overexpressed in a variety of solid tumors (22). Correlations between altered miR-21 expression and malignancy-related cellular processes, including proliferation, migration and apoptosis, have been well demonstrated (6,10,19). These correlations indicate that the upregulation of miR-21 in EEC participates in the pathogenesis of endometrial cancer.

In the present study, we found that PTEN protein and mRNA expression were decreased in EEC tumor tissues compared with matched non-tumor tissues. Although several studies have revealed various frequencies of somatic PTEN mutation in EEC (2), the values are not adequate to explain PTEN inactivation in EEC and in several other tumor types (3). Other mechanisms participate in the loss of PTEN protein. PTEN has been validated as a target gene of miR-21 in a variety of malignancies (5,6,9,23) but has not been reported in EEC. In the present study, matched analysis of miR-21 and PTEN protein expression in tumor tissues showed a significantly negative correlation. Thus, we postulated that PTEN was also an important target of miR-21 in EEC. Although the negative correlation between miR-21 and PTEN levels suggests a regulatory role for miR-21 in PTEN expression, a conclusion cannot be drawn until direct evidence showing that the reduction or overexpression of miR-21 alters PTEN expression is found. In this regard, synthetic miR-21 mimic or inhibitor was transfected into the KLE cell line to test the effect of overexpression and inhibition of miR-21 on PTEN expression in EEC tumor cells. Our results showed direct evidence that miR-21 regulates PTEN expression at the protein, but not the mRNA, level. To further confirm that miR-21 directly targets the 3′-UTR of PTEN mRNA, we constructed luciferase expression plasmids containing the putative binding sites or mutated seed region sequences in the 3′-UTR of PTEN mRNA for miR-21. Our results verified that the PTEN 3′-UTR had target binding sites for miR-21.

In the present study, transfection of miR-21 increased the cell proliferation of the KLE cell line and transfection of the miR-21 inhibitor inhibited it. Given that PTEN expression and cell proliferation are regulated by miR-21 and that PTEN has been shown to repress tumor cell proliferation by blocking the PI3K/AKT pathway (24), it may be inferred that the alteration of cell growth modulated by the expression of miR-21 may be partially mediated by the PTEN/PI3K/AKT pathway. Other putative targets besides PTEN or other miR-21-mediated mechanisms may also participate in the alteration of cell proliferation of the KLE cell line. Further research should be performed to elucidate those underlining mechanisms.

Several aspects of the mechanism of miR-21 dysregulation have been shown. In gastric cancer cells, the suppression of nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) activation has been reported to enhance miR-21 expression and it has previously been found that NF-κB may be activated by estrogen in endometrial cancer (25). The regulation of miRNA is a complex network. Further research is needed on the definite mechanism leading to the dysregulation of miR-21.

Above all, our study demonstrated that miR-21 was overexpressed in EEC and determined that this miRNA downregulates PTEN expression via binding to the 3′-UTR of PTEN mRNA. In addition, we found that miR-21 promoted cell proliferation in EEC cells. The characterization of miR-21 as an oncogene provides evidence of its potential as a therapeutic target in EEC.

Acknowledgements

This study was supported by a grant from the Scientific Research Foundation for Shandong Provincial Scientific and Technological Projects (2009GG10002056) and a grant from the Shandong Natural Science Foundation (no. ZR2010HM005).

References

1. 

A JemalR SiegelE WardJ XuCancer statistics, 2010CA Cancer J Clin60277300201010.3322/caac.20073

2. 

H TashiroMS BlazesR WuMutations in PTEN are frequent in endometrial carcinoma but rare in other common gynecological malignanciesCancer Res573935394019979307275

3. 

A PerrenLP WengAH BoagImmunohistochemical evidence of loss of PTEN expression in primary ductal adenocarcinomas of the breastAm J Pathol15512531260199910.1016/S0002-9440(10)65227-310514407

4. 

DP BartelMicroRNAs: genomics, biogenesis, mechanism, and functionCell116281297200410.1016/S0092-8674(04)00045-514744438

5. 

YS LeeA DuttaMicroRNAs in cancerAnnu Rev Pathol4199227200910.1146/annurev.pathol.4.110807.092222

6. 

F MengR HensonM LangInvolvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell linesGastroenterology13021132129200610.1053/j.gastro.2006.02.05716762633

7. 

F MengR HensonH Wehbe-JanekMicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancerGastroenterology133647658200710.1053/j.gastro.2007.05.02217681183

8. 

IA AsanganiSA RasheedDA NikolovaMicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancerOncogene2721282136200810.1038/sj.onc.1210856

9. 

LB FrankelNR ChristoffersenA JacobsenProgrammed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cellsJ Biol Chem28310261033200810.1074/jbc.M70722420017991735

10. 

S ZhuH WuF WuMicroRNA-21 targets tumor suppressor genes in invasion and metastasisCell Res18350359200810.1038/cr.2008.2418270520

11. 

Q YaoH XuQQ ZhangMicroRNA-21 promotes cell proliferation and down-regulates the expression of programmed cell death 4 (PDCD4) in HeLa cervical carcinoma cellsBiochem Biophys Res Commun388539542200910.1016/j.bbrc.2009.08.04419682430

12. 

ML SiS ZhuH WumiR-21-mediated tumor growthOncogene2627992803200710.1038/sj.onc.121008317072344

13. 

S ZhuML SiH WuYY MoMicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1)J Biol Chem2821432814336200710.1074/jbc.M61139320017363372

14. 

W QinB ZhaoY ShiBMPRII is a direct target of miR-21Acta Biochim Biophys Sin (Shanghai)41618623200910.1093/abbs/gmp04919578724

15. 

D SayedS RaneJ LypowyMicroRNA-21 targets Sprouty2 and promotes cellular outgrowthsMol Biol Cell1932723282200810.1091/mbc.E08-02-015918508928

16. 

A TorresK TorresT PaszkowskiHighly increased maspin expression corresponds with up-regulation of miR-21 in endometrial cancer: a preliminary reportInt J Gynecol Cancer21814201110.1097/IGC.0b013e318200050e21330826

17. 

J SnowdonX ZhangT ChildsThe microRNA-200 family is upregulated in endometrial carcinomaPLoS One6e22828201110.1371/journal.pone.002282821897839

18. 

LA RamónA Braza-BoïlsJ Gilabert-EstellésmicroRNAs expression in endometriosis and their relation to angiogenic factorsHum Reprod2610821090201121335415

19. 

Q PanX LuoN CheginimicroRNA 21: response to hormonal therapies and regulatory function in leiomyoma, transformed leiomyoma and leiomyosarcoma cellsMol Hum Reprod16215227201010.1093/molehr/gap093

20. 

DE CohnM FabbriN ValeriComprehensive miRNA profiling of surgically staged endometrial cancerAm J Obstet Gynecol202656 e18201020400061

21. 

EJ LeeY GusevJ JiangExpression profiling identifies microRNA signature in pancreatic cancerInt J Cancer12010461054200710.1002/ijc.2239417149698

22. 

S VoliniaGA CalinCG LiuA microRNA expression signature of human solid tumors defines cancer gene targetsProc Natl Acad Sci USA10322572261200610.1073/pnas.051056510316461460

23. 

WJ MaGD LvA TuersunRole of microRNA-21 and effect on PTEN in Kazakh’s esophageal squamous cell carcinomaMol Biol Rep3832533260201121104017

24. 

PK VogtM GymnopoulosJR HartPI 3-kinase and cancer: changing accentsCurr Opin Genet Dev191217200910.1016/j.gde.2008.11.01119185485

25. 

KH SeoHS LeeB JungEstrogen enhances angiogenesis through a pathway involving platelet-activating factor-mediated nuclear factor-kappaB activationCancer Res6464826488200410.1158/0008-5472.CAN-03-2774

Related Articles

Journal Cover

December 2012
Volume 4 Issue 6

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
APA
Qin, X., Yan, L., Zhao, X., Li, C., & Fu, Y. (2012). microRNA-21 overexpression contributes to cell proliferation by targeting PTEN in endometrioid endometrial cancer. Oncology Letters, 4, 1290-1296. https://doi.org/10.3892/ol.2012.896
MLA
Qin, X., Yan, L., Zhao, X., Li, C., Fu, Y."microRNA-21 overexpression contributes to cell proliferation by targeting PTEN in endometrioid endometrial cancer". Oncology Letters 4.6 (2012): 1290-1296.
Chicago
Qin, X., Yan, L., Zhao, X., Li, C., Fu, Y."microRNA-21 overexpression contributes to cell proliferation by targeting PTEN in endometrioid endometrial cancer". Oncology Letters 4, no. 6 (2012): 1290-1296. https://doi.org/10.3892/ol.2012.896